Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1558
Length(NT) : 838
Best Gene Model Blast : Link to GSTUMT00006113001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: zinc finger protein
Accession: ref|NP_592812.1| Score: 171 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: spo:SPAC11D3.17 Score: 171 E_value: 6e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q10096|YAOH_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1558
TTGGACCGAACTAAACAACCCAAACCAAATAAACTCCACACCCAAATCCA
AACCCAAATTCAAAAAAAAGTAACCCTCTTTTTTCCCTCTTTCGCTTTCT
TCCCCCTATCTTATACCCTCATAACCACAACTTCCAGACAGACCAGACTA
CCTCCTCTCAGCCATTCATGGCGAGGAAGAATAATAATCGGAAGAGCCCA
ACGGTAGCTTCGGGGTCGAGGGGTTCTGGAACCGGTGCCGTTTCCCAGGC
GTTGCGGCTGAGGCGCTGGATAGATATTCAACTTAAGGATGTGCTCGAGG
AGAGGGCGAGGGGAAACTGGACAGAGGAAGATGAACGTGAATGGCGGAGG
ACGAAGCCCTATGAGTGCGAAACGTGCAATGAGAGGTCGTCCACGAGATA
TAATAACAACAGACATAAACTTAATAAGCACTCTACGAAGAAAGTCCTGA
ACTGTACGTTTCCGGGATGTAAATTGGTGTTCACGAGACCTGATAACCTC
GCCAAACACCAGAAGAAGCATCATTCTGCGAGTCAGAATGACCCAGAGGA
CGAGCCACGCGATGATGTGGAGAAGTTGACGTCTCAATTCTGGAGGCGCT
TCCCCATTGCAGACGATTTGCCTAAAAAGCCAGTGGATGGGCTCAGGATT
TACTATACTCCTGGGAAACTCCCTTTCTTACCTCCGGAGGTCATTTCCCA
TTATGCGGATTACTACTTTGCCCCCACGGCCTTTCATCCGTTTCTCCCAT
TGCTGCATAAGCCCACCTTTCAACCCACAACCGTTTTGGCGAGCTTCCTC
AGAAGTGTATGCGCGCTTGGTGGGCGTTACGATCCGAC

Sequences in the Contig:

SY0AAA20YH11FM1 SY0AAA22YH08FM1 SY0AAA53YG12FM1
SY0AAA54YM11FM1 SY0AAC36YE01FM1