Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1557
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00011220001 E-value : 1e-32
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1557
TTGGGACAACCCTACGGGCACATCGCTTTGCTCCCGCTCGATCTCCGATG
TGAAATACCGGTACCGTACAGGGCGGGCTTAAGGACCATCTCTCCCTGAG
AAGTGAATTCCTCTGTAGCCCCCGACATGCTCCGCGAGGGACCAAAGTTC
TCTCTTTCGGTTCGGCGGGTGCTGACATAGAAATACCGGTAAAATACCGT
ACTGTGTGGGCGGGATGAGGGCTGCAGCAAGTATGTGCTTTACATTTTTC
CTGCACGCTACAGTATCACAGACAGCGCAATCCGCATCTCCCGGTCAACT
TATTTCAGCATCTCCTCATTATACCGCCTATCGCGGGGGCGAGTGGGACA
ACAATGCATTGCATACCTGGCCGCAGAGCGGAACCCTACCCAGTTGATGT
TCAAAAGTTTCTGCAGGCCTGCACCTACTGACCTTTTCTAGCTCTTGATG
GACAAGATTAATCATCCATGGGTCACGGGCTTTCGTTTTACCCGATGCTG
TCCACCTCTTATCGTACTTGGGTAGTAGATAAATAGAGGGAACCCAGGGC
GGCGTAATAACCATCGTTCTAACTTGTTACCACAAAATGTCCCTCCTCGA
TGTTCCGAACGAATTACTGCTCCTGATTGCGGAAGTTCTTGATCCGAAAG
ACCTTA

Sequences in the Contig:

SY0AAA54YM10FM1 SY0AAC22YA11FM1 SY0AAC41YB14FM1