Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1556
Length(NT) : 633
Best Gene Model Blast : Link to GSTUMT00008919001 E-value : 1e-50
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_03050
Accession: ref|XP_001243609.1| Score: 295 E_value: 3e-25
KEGG Definition: 40S ribosomal protein S25; K02975 small subunit ribosomal protein S25e
Accession: aor:AO090005001059 Score: 295 E_value: 2e-25
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1767 Score: 341 E_value: 4e-33
PFAM Definition: Ribosomal_S25, S25 ribosomal protein..
Pfam Number: pfam03297 Score: 342 E_value: 3e-33
Swissprot: Q7SC06|RS25_NEUCR

Sequence:
>Contig1556
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAATAATCAAGCTAAGCAA
CGACGACGAGGGCACTTGAATCAGAAAATAAGACGACCCCCGACCGACGA
TACGACAAAAATTCGATAACTTTTGTGAACCGATAAACATCTAAGTCATG
GCCCCCGCAGCAGCACAAGGTGGAAGGAAACAGAAGAAAAAGTGGTCCAA
GGGAAAGGTCAAGGATAAGGCTCAGCATGCCGTCGTCGCCGACAAGACCA
TTCAGGACAAGCTCAATAAGGACGTTCAAACCTACCGTCTCATCACTGTT
GCTGTCCTCGTCGACCGCTTGAAGATCAATGGCTCATTGGCGAGGAAGGC
GCTAGCAGACTTGGAGGAGAAGGGCGTTATCAAGAAGGTTGTCGGCCACT
CAAAGTTGTCGATTTATACTCGCGCGGTTGCGGCGGCGGAGTAGTCTCTT
TGTGAAATAATGGGTTTCTATTAAATCAAAAAAAAAGTAAAAGGTCAAAT
TTTCTATCCTTGCCACGTTCCAGAGGTTCTTTCTAGAAGGGTTTCTTCGC
GTTTTACTCGGGAGGTCGGGCCGAAGGGGGGGACTAAGGCGGATGGTTAT
GTTTTTTTTTTTCTTGGCAGGGAACGTTATCAG

Sequences in the Contig:

SY0AAA54YL04FM1 SY0AAC54YA11FM1 SY0AAC57YJ12FM1