Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1555
Length(NT) : 781
Best Gene Model Blast : Link to GSTUMT00005015001 E-value : 1e-165
Numbers of ESTs : 5

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001410516.1| Score: 140 E_value: 5e-07
KEGG Definition: predicted protein
Accession: mgr:MGG_11445 Score: 140 E_value: 2e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1555
TTGGGTAAAAATTGCAAGTCCCACGTTCATCTCATTTACATCGCTAAAGA
AATCGACCATCTAGCCTAACTTGGAAAAACGAAACCGGTCCAAGGATAAC
GATAAAGGACGGAAAAGAATAGGAAAATAAAGGAGATACATATAAGGAAA
GGAAAGGAAAAACAGCAGCAACAGCTTCGACAGGATGGTGAAACCATGGG
GGAAGCACAAAAAAATTCTTCACGAACTCTACATATCCAAAAAGAAGAAG
TTGGAGCAAGTGATGGAAATCATGGAAAAGGAGCGTGGCTTTGTGGCTTG
CCGGAGGGCGTATATGAAGACGTTCCGCAAGTGGGGATACCAAAAAAATA
GGAAGTCTCGAACAGCCAGCAGAGAGAGTGGGTCGTCAAGAAAAATAAAT
ACAAGACTACGCTCTACCGTGGAACCACCGTGCGAACCGCCCGAGGTAGC
CCTGGAGGCCCGGGTGAATACGCACGAAGCAAATCCCTACAATCCTACAC
CCACACACAAGATTAATGTTCGAGGAACCACCTCCACGGAGCCAATGGTC
AGCCATCAAGCCACTGGTGGACTTGCCTCCCCCTTGGATAAATTCAAAGA
TTCCGATGATTTGAATAAATATATCAAATTGTTAGAGGGAGTTCTCCTCC
TCAACGAGATTAAGAAGAAGGCCCTGCTCTCTGGGAACCCTGACCCCCAC
TCCCCTGTGATGTCAGACTACCAGCAAGTCCTAGAGAGAGTGTTGTCCGG
CGACCCCCCTATTGCCTAAAATCAATCGAGC

Sequences in the Contig:

SY0AAA14YF11FM1 SY0AAA54YK22FM1 SY0AAB29YM24FM1
SY0AAB34YL17FM1 SY0AAB51YD04FM1