Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1554
Length(NT) : 1219
Best Gene Model Blast : Link to GSTUMT00005862001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein FG06193.1
Accession: ref|XP_386369.1| Score: 193 E_value: 7e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG06193.1 Score: 193 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1554
TTGGGAGACCATCATATGAGCGCAAAATCTCAGAGCCAACATCCTACCGG
GAAACCGAAAAGAGCAGGCCACCACTGCCACTACACATCGCATCTCAGGA
GAAGGGTCGCCAAATTCCTGGAAGTGGAGATGGTATGGATATGGAAATGG
GGAGGAGATCGGGAGATTCTGGTAGGAATGGTGGGGATAAGAAGGAAAAG
TTATACTTCAACAAGGATCTAACCTCAACTTACAGCTCTCCGTATATCTC
AAGGGAGCCATCCAAGCAAGAGCCCGATTCTGACACTGCCAGTACCAAGT
CTAGGAGCACCGTCCTTGCCAAGGACTCACCCGGACATGCGCAGGAAAAG
GAGAACTTTAAGCTCGGAGAGGTGCCGCGGGAGAGGAAGAGGTCATTGGG
CACACCAAAGATCATGGATGGGGAGGAGCTAGATCCCCATGAGATATCAG
TATCATTCTTGCCCATGGATTTGGAAACTGCGCCTTCAGTGGCTGCCCCC
GAGATACCGCCCCGTGGGGATTCATATAACCTGCCTATTTCGCGCGGGGA
TTCGCCAACTTCTGTTGCTAGGAAGCCCGTCGATTTAGAATCACCTGTTC
ATTCGGCTTCTTCCTCTGGACATTCGCAGCGCTCCCATGGAACATCCGGA
TCCAATGCTTCTGCAATTACAGCTGCAGAATCACCTGAGGTTGGGCTGGG
AGCCAAGGATACTACCGATTCTAAACCACGAGGGATCAAGATCAATACTA
CTACAACCGTTAGCAATATTACTTATCAGCAGGATCCTACTTTCTCAACT
CAAACTACACTTGACCAGCAACCGGGGGCCCCACAGCCTCCGTCCACTGT
ACATGCCTCGGGCTCTTCTAGTTTTAGTCCACAGGGGGAACCGGTAGGTC
TAGATGGGTCGGTATTGCCACCACCGTTCAAGTCGCCTGTTAGCGATTTG
AGCATGGAAGAGGATATCGCAAGGGTTTTTGGTGGTGGAGATACATCGGC
ATCCATACTTCGGCGGGTGTCGAACGCTGTTATGCATGGAAGAAGTTTTA
GCGATTTGGCTACTAGAACGGGATCGCCCCCCAAGTGGCCAAGATCACCA
AGTGGAGGGGATCCGGGATACCTTCCGTTTGAGGGCGACATTACTAGTCC
GACGTTGTCATTAGGTGGGAAAGACGATACCCTTACCCTAAAGCACGAAC
TTCGACGTTCGATGCAAAG

Sequences in the Contig:

SY0AAA54YK03FM1 SY0AAB24YM16FM1 SY0AAB26YL02FM1