Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1553
Length(NT) : 1787
Best Gene Model Blast : Link to GSTUMT00002286001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: protein kinase, putative
Accession: ref|XP_001259253.1| Score: 454 E_value: 6e-43
KEGG Definition: serine/threonine protein kinase Chk2 and related proteins
Accession: aor:AO090113000066 Score: 444 E_value: 4e-42
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0615 Score: 420 E_value: 1e-41
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 469 E_value: 2e-47
Swissprot: Q09170|CDS1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0000076 = Biological process: DNA replication checkpoint
GO:0031573 = Biological process: intra-S DNA damage checkpoint

Sequence:
>Contig1553
CCTTAACCCCCTGAGTTGCTCTTGGGTACCTAAATCACCATCGCGACGCG
ACCCTCTCCTCTGCCTTCTATAACATCAGTGCTGTACAGTGCTTCGTTCT
TCAGGACCCATGGTTGTGAAGACCGCGGATCAGCATATGCGAGAAAGCCG
TGGGGTTCCGCTAAGGCTCCTACGTCGACGTTCGAACATTTCGTCCGCGG
ATAAACGCAGCAACTTGACCCCCTCAGAAGAAACTGGTCCTCGCTTTAGG
TTGATTAACGATAACGAAAAGCGGGGATGGTCGTATATTCCTGCACGACC
GCTTGATCCCGAATCATCAATATCCGAGTCGGGGGAGGCGGATAAATATT
CGTGCTTTGGTGACTCGGACGATGAGGAGGGGCACAAGCCAGCGGTACCT
TGGTTTGGGCCGCAAAACAAGAGGACTGAGCAGAAAGGGGACAGGAATAA
TGACGGGGGGCATGGGTTGCGGCGCGTGGGGAGTATTGAAGTGTCCTCCG
GTCGGAACGAGATGCGCACACCTCAACCTCGCCCGTTAAGAACATTACAG
AGCATGAATGATCTGCGACCCGGAATGGTACAGGATAACATTGCGTCCAT
CTTTGAGACGCCGAGATTACAAAAGTCGCAAACATTTCCACGTTCGGAGC
GTCCACAGCTGAGGGCAATGGCGAGGGCGCCCAGCCCCGTGCGCGAGCAG
GATGAAACCGCACCGGAGAAATTTGATCACCAACAAGACTCCAAGTTTGA
TTCTTGTAAGTTGCAATCTTACTTTCGCGGTAGTTTTATAGAACATGTTG
TTTGGCGCTCCAAGTCCCAGTGCGAGATCACGAAATGGGATCGAAGCGGG
CTACTAGGACGTGGGACATTCGGAACCGTTTGGCTGGAAAAAGAGAGCCG
GCGGGGGACGCTACGGGCACTAAAAGAAATGCGGAAGGATGTTATAGGAC
AAGACTATAACCGAGAGATACTTGCCTTAGTAAAACTGAAGAAATATGAC
AAATACTTTGTCCAATTCTTCGGATGGTTCGAGGATCCCCAGTGTATATA
CCTTGCAATGGAGTATATCGCACTAGGTGACCTGGATCAATGTTTTCGAA
AAAAGACATTCACAGAAGGACGAGCCAAGCTCTTGGCATGGCAATTACTG
CAAGGGCTGGCCATCATGCACGAGAACGGGTTTACCCACCGAGACTTAAA
GCCACAGAATATTTTGCTGGTATCTTACTATCCCTTATGGGTGAAGATTG
GAGATTTTGGCGTGACGAAACGCATCATTCACGACGAAACCGCACTCAGG
ACCAGTGTCTGGACTATGCACTACGGAGCTCCAGAAACGCTGGGCTTAAC
TGACGCCGAGACTTCAGAATACACCAACGCAGTTGACCTCTGGTCCCTAG
GTTGTGTCCTGCATAAGGCCTTGACCAATACCACGCCCTTCACAAATATG
AGGGCTTTTTCGGCATTTTGTCATCAACTCATCGTGTTTCCTTCCGCCAA
GCTTTACGAGAGCGACGTTAGCCATTCGGGGATTGATTTTATCTTGAAAC
TTATGGCATTGGATCCGTCGTTGAGGCCAGCTGCAGAGGAAGCACTGAAG
TTGGAGTGGTTCAAGCCCAAAAGGGTTGTCGCAGAGGCCGGGAATGGACC
GGGAGCGGGATTTTCGGGGAAGAGCCCCAGGTCGCCGCCTACTACGCTGT
TGCCCCAGCCGCCGCGATGGGTGTCTTCCCCAGCTGCCAGATGCAACTGC
CAGAACTGCCTGCATTACTCTTGACGTGTCGCTTCGC

Sequences in the Contig:

SY0AAA13YJ02FM1 SY0AAA14YB10FM1 SY0AAA18YD01FM1
SY0AAA3YP09FM1 SY0AAA44YO11FM1 SY0AAA50YK05FM1
SY0AAA54YI13FM1 SY0AAB29YF20FM1 SY0AAB44YM13FM1
SY0AAB49YA03FM1 SY0AAB52YJ16FM1 SY0AAC22YO10FM1
SY0AAD33YK09FM1