Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1552
Length(NT) : 574
Best Gene Model Blast : Link to GSTUMT00005055001 E-value : 1e-129
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_11365
Accession: ref|XP_001801609.1| Score: 250 E_value: 4e-20
KEGG Definition: predicted protein
Accession: aor:AO090001000531 Score: 233 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1552
TTGGCGCCCGTCAAAAAAAAAAAAAACTCTCTTCCTCACTCCTGATCCCT
CCAGTCCCTTTACCTCCCTTCCCTATCTCCTCTCACCTCTCCCACTTCTC
CTCCTTCTCTCACTCTTTCCATCTTCATACGGTATTTCCTGTATCACTTC
CCTCCCCCGCCTTTCCGTTGATCTACAAATTGTAGTCTTCAACCTGTCTT
CGCTTCGATACTTCTCTATTCAACTACCCTCAGCTTTCCACCCCTTGACC
CTCACTGACCTTCCACGCCAAGGCCAACTCGCCGAAGCGAGTGTTTCTTA
ATTATCCTTGACTTGAGGAAAGAATAAGTAATAATAGTAATCATGAGTTT
TAACCTTAACACGCACCAATTTGAGAATGGTAGACGGTTTCATGGCTACC
GAGGTGGTGCCTACATGTATCCAAACGATGAGAAAGAGCAAGACCGCCTT
GATATCTACCACAAGATGTTTCTTGTTGCACGGCAGGAGGAGCTTCACCG
TGCCCCAATCACCAGAAATTATTCCCCACCCAGAATCCTAGATCTCGGTA
CCGGAACCGGTATTTGGGCCATTG

Sequences in the Contig:

SY0AAA42YD09FM1 SY0AAA54YH24FM1 SY0AAB51YI15FM1