Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1551
Length(NT) : 870
Best Gene Model Blast : Link to GSTUMT00010365001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541987.1| Score: 491 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: fgr:FG00642.1 Score: 441 E_value: 3e-42
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1551
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTCTATGATAGCTCTTCA
GCCTTGATCCACCTAATAATCATCAACATGTATACAAAATTTCTTGCTTC
CATCATCTTGGGATCTACATTCTTTATGCGGGTAATGGGACATATGAACA
TGATGTCGCCACCTCCTATGCGACACCGAGACAATCCTCACACCCAGACG
GTTGACGAGATCTACGAGTTTCCTTTGAAAACCGACGGCTCTGATTACCC
GTGCAAAGGCCATATCAATGCTCTCGGCACGCCAGAGGGTCAACCGGTCG
CGACATGGGCCGCCGGAAGTGCGCAGACTTTCAGCCTGGAAGGAAGCGGC
ACCCACTATGGCGGTAGCTGTCAAGTCTCCCTTTCCTACGACAAGGGCGA
GACGTTCAAAGTCATCAAGAGCTGGCCAGGCTCCTGTCCCAACCGTGAAA
ACGGCTCAGACCAGACTTTCAACTTTAACATCCCGAAGGAAGCTCCCAGC
GGGGAGGAAGTCATCTTTGCCTGGACGTGGAACAACCGTGAGCGCGAATT
CTTCCAAAATTGCGCCGTAGTAACCATCACCGGTGGCGGTGCTGGCATCT
CAGGGCTGCCGGATGTTTTGGTCTCCAACATCGGGAATGGGTGCCTTTCC
CCGTTGACTACCGCCGAACTGAAGTATCCCGATCCCGGCACCGCTGTCGA
GCTCGGCGACGGGGAGTACCCGCTCGTTCTCCCCACTGGGAACTGTTAGG
CGGGGTGTTGGATACATCACACGCCGGCATCTGTACCGCGGCCGTCACGC
TTGTTCTGTTTTTGTTTGCCTATTTCCTCCTCAAAAGTGTCCGGACCCCA
AGGGCTGTCTTCTTGTATTT

Sequences in the Contig:

SY0AAA54YH19FM1 SY0AAA5YA10FM1 SY0AAA63YB24FM1