Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1550
Length(NT) : 1328
Best Gene Model Blast : Link to GSTUMT00002741001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An07g06130
Accession: ref|XP_001391691.1| Score: 1170 E_value: 1e-139
KEGG Definition: hypothetical protein
Accession: ang:An07g06130 Score: 1170 E_value: 1e-140
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG1517 Score: 956 E_value: 1e-104
PFAM Definition: No Hit Found
Swissprot: P87141|MIP1_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0031931 = Cellular component: TORC1 complex
GO:0005515 = Molecular function: protein binding
GO:0031137 = Biological process: regulation of conjugation with cellular fusion
GO:0031929 = Biological process: TOR signaling pathway

Sequence:
>Contig1550
AATAGACCCCCAGACGCGAACGACCCACAGAGCTCGTCCACAAGCTATCG
CACTGCCAAGGAACCGATTACTCGTAATTTTCATGCTAAAGGAGTTGACA
AGATTCCTAGTATTCCGCTTAAAAGCCAGTTTATGGAATGGTCTATTGAG
TACTTCCGCGAGCCTCAAATGAAACCGAATGAGGCCGACGAGCCGGGCAG
TGTTGATTATAACCAGCGTTTGTGGCGTAGAACGCGAAATGACAGGATTA
TCATCGACACACAGACTCAAAAGGAGCGGGCGAGCGCTTCAAGATGGGAT
CATAATAAGGGTGTTTTCAACAACGGGAGCCTTCCTATGAGGTTGCTGTT
TCATCAGTTCGAGAGCCATCTCATAGCTGTGGATGAAAAGGATAGTGTAT
CGGTATGGGACTGGGCAAAGGGTGTGAAAACCAACCATTTTTCGAATGGC
AATCCTACCGGCACAAAGATCACTGAGATTAAGTTTCTTAATGAGGACGA
TGTTGCTCTATTGATGACTGGTAGCGGGGAGGGTGTCGTTCGTATTTACC
GGAATTATGAGAATGACGGTGAAGTCGAGCTGGTCTCTAGCTGGAGAGCT
CTTACCGATCTGTTGCCTTCTAGGAGAAGCTCTGGGTTGGTTGCTGAATG
GCAGCAGGGAAGGGGGACAATGCTCGTCGGAGGAGATGTGAGGGTTATCA
GAGTCTGGGACGCACCGAGGGAGATGTGCATGAGTGATATCCCCGCACGC
TCCGGGTCCTGCATTACCAGCTTGACATCTGAACAGGTTGCTGGCAACAT
CTTTGTAGCTGGCTTCGGTGATGGAGCAGTCAGGATATATGATCGCCGTC
TGGCGCCTCGAGACTCGATGGTGAAGGTTTGGAAACAACACAAAGCCTGG
ATTGTAAAAGCGCACATGCAACGAGGTGGCATGCGTGAGTTGGTATCTGG
AAGTGCAACGGGCGAGGTCAAGCTCTGGGATATCCGCATGGATAATCCGG
TTAGGGGATTCCTCGCACATACAAAGGGAATGAGAAGCTTGAGTGTTCAT
GAGCATGCTCCTATCATTGCAACGTATAATAACCCCACAAATTCCTTACC
CCTGTCCGTTATTTTCCTGCTTTTATGAAGGCTAATAATCCATCGGTAGT
GGCTCAACCTGGCATGATGTGAAACTCTGGAATACCTCTACTCCCAAGGA
CCTCCCACTCTCAACAATAAAGCCCTACAGCAGCTTCCTACACCAGAACC
GCAGCAATCCCGTGACCGGACTCGCTTTCCACCCTCACCGGATGATGGTA
GCCTGCTCCGGCGCTGGAGACAACCATA

Sequences in the Contig:

SY0AAA24YN11FM1 SY0AAA24YN11FM2 SY0AAA54YG07FM1
SY0AAD38YH15FM1