Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig155
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00005003001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_12126
Accession: ref|XP_001802358.1| Score: 357 E_value: 2e-32
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06828 Score: 345 E_value: 2e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 390 E_value: 9e-39
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 206 E_value: 2e-17
Swissprot: P53322|TNA1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0015663 = Molecular function: nicotinamide mononucleotide transmembrane transporter activity
GO:0015890 = Biological process: nicotinamide mononucleotide transport

Sequence:
>Contig155
TTGGGGTGGGTTTGCGCCCCGATCTTGAGTCCTGGACCTACAGAAACGGT
ACCGTGGACCACCGCACAACATGGAGGACCAGAACGTAGTGAAGGAAACC
CTCGACGAGAAGTACGAGATAGCATCTGATGAGGGGTCGTGGTCGGCCGA
GGAGGAGGCACAGGTGAGGAGGCAGCTGGATTGGAGATTGCTACCGCTGT
TGGTAGTGCTGTATCTGCTTTGCTTTCTCGATCGAGCAAATATCGGGAAT
GCACGGATTCAGGGGATGCAAAAGGACCTAAATCTTGTCGGGTTTAGGTT
TAATTGGGCGTTGACCGCGTTCTATATTCCCTTTCTTCTTATTGAGATTC
CGAGCAACATATTACTCAAGAGGATAGGTCCAAAGATTTACATCCCCGCA
ATCATAATAGCCTTCGGCATTGTGTCAATGGGGACGGCATTTGTGAGAAG
TTTCCAGGAACTATGCGTAGCTCGTGCATTCCTGGGACTCGCAGAGGGGG
GAACAATGCCGGGAATGGCATTCTTTATGAGCTGCTTCTATAAGCGGGCC
GAGCTACTCTTCCGGGTAGGGCTCCTTGCCTCGGCTGGTTCGCTCGCCGG
AGCGTTCGGTGGA

Sequences in the Contig:

SY0AAA15YL06FM1 SY0AAB35YN09FM1