Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1549
Length(NT) : 976
Best Gene Model Blast : Link to GSTUMT00001645001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein FG01686.1
Accession: ref|XP_381862.1| Score: 436 E_value: 2e-77
KEGG Definition: hypothetical protein
Accession: fgr:FG01686.1 Score: 436 E_value: 9e-78
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0023 Score: 413 E_value: 3e-41
PFAM Definition: ADH_N, Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure..
Pfam Number: pfam08240 Score: 227 E_value: 1e-19
Swissprot: Q04894|ADH6_YEAST
Gene Ontology:
GO:0005625 = Cellular component: soluble fraction
GO:0008106 = Molecular function: alcohol dehydrogenase (NADP+) activity
GO:0033833 = Molecular function: hydroxymethylfurfural reductase (NADH) activity
GO:0033845 = Molecular function: hydroxymethylfurfural reductase (NADPH) activity
GO:0006066 = Biological process: alcohol metabolic process
GO:0033859 = Biological process: furaldehyde metabolic process

Sequence:
>Contig1549
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGGACAACTTTGTACAA
AAAAGTTGGCTTATACCTAGCGAGAAGCACATCAGTAACTACAAAAAAGA
TAAAATCGACGAAAACAGCGAGAAAGCAAAGCCCAATTCTAAGAAGATGT
CTACAGAATACTCTTTCAAGGGATGGGTTGGTTCGAGCAATGATTGTATC
GAGAAGCAGAACCTTGTCTATAAGGATATCGAGCCTAAGAGATTCACGGA
GGACGATGTGGATATTCGGATCACCCATTGTGGTATTTGCGGGACTGACG
TCCACACCCTGACGAACGGCTGGGGCTTCACGAGCTATCCCGTTGTTGTC
GGCCACGAAATCGTCGGCACGGCAGTGAAAGTTGGGAAGAACGTCCAGGG
AATCAAAGTCGGTGACCGGGTCGGTGTAGGTGCACAGGCAAGCTCCTGCT
TGTCGTGCGGTGAGTGCAATGCTGATAATGAATCCTATGTATTTACCCTC
CCATCACCAACACTTCTTCCTTCAGACAGTTGCTCATGAGGTGGGAGTAG
TGCAAGGACATGGTAGGAACCTATAATGGCAAGTACCCCGACGGCAGCAT
GTCCACTGGTGGATTCGCCGACTACACTCGTGTTCCTGGCCACTTCGTTT
TCAAGATCCCGGAGGCACTCTCTAGTGAAATCGCTGCGCCCATGCTCTGC
GGTGGAATAACCATGTTTTCACCCTTAAAGCGCAATGGCTGCGGACCCGG
AAAGACTGTTGCAATTATCGGCTTTGGAGGTTTAGGACACTTCGGCGTCC
TCTTCGCAAAAGCCCTCGGTGCGGACAAAGTCATTGCCATATCCCGCAAA
CCCAACAAGGCGGCTGACGCTCTCGCTATGGGCGCCGACGACTACGTCGC
GACTGACGATAACCCTAACTGGGCAAGCAAGCACGCCAACACCATCGACC
TGATCGTGTCCACTGTGAACTCCCCC

Sequences in the Contig:

SY0AAA40YO06FM1 SY0AAA47YH09FM1 SY0AAA54YG04FM1
SY0AAB17YG12FM1 SY0AAB7YE21FM1