Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1546
Length(NT) : 1197
Best Gene Model Blast : Link to GSTUMT00009774001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: proteasome-activating nucleotidase
Accession: ref|XP_001538711.1| Score: 1500 E_value: 1e-164
KEGG Definition: proteasome regulatory particle subunit Rpt1, putative; K03061 26S proteasome regulatory subunit T1
Accession: afm:AFUA_3G07820 Score: 1487 E_value: 1e-163
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0729 Score: 1691 E_value: 0.0
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 445 E_value: 1e-44
Swissprot: P33299|PRS7_YEAST
Gene Ontology:
GO:0008540 = Cellular component: proteasome regulatory particle, base subcomplex
GO:0016887 = Molecular function: ATPase activity
GO:0004175 = Molecular function: endopeptidase activity
GO:0042802 = Molecular function: identical protein binding
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig1546
TTGGAACAAACTCAACCTTCATCTACCCTCCACGCTATCGACCAACTCCA
TCATCCCATTTATCTATCACCTACTAGATCCTATCAGCATCTTTGAGATC
TGCTTTAGGACGTTTCAGCTCTACGCCAACCACCATGCCAAGTGCCACTG
GAAAAGACTGGGAAAAGTACAAGAAGTTCGCTGACGAAGAGGAGGACGAG
AAGAAGATTATACCACTATCGGAAGAAGATATCCAAGTCCTGAAAACCTA
TGGCGCTGCCCCCTACGCTGCATCTCTAAAGAAACTCGAGAAGGATATCA
AGGACTTACAAACTAAGGTTAACGAAAAAATAGGTGTCAAAGAATCGGAT
ACGGGGTTGGCCCCACCACATTTATGGGATGTCATGGGGGACAAGCAGCG
CATGTCTGAGGAGCAGCCGTTACAAGTTGCGCGCTGTACCAAGATCATTC
AGAGTGCAGATGACCCAGAGAAGGCCAAATATGTGATCAACGTTAAACAA
ATTGCAAAATTTGTTGTTAACCTTGGGGAACGAGTGTCTCCAACCGATAT
CGAGGAGGGGATGAGGGTTGGCGTTGATCGACAGAAGTACCAAATTCTTT
TGCCTCTTCCTCCCAGAATCGATCCTTCGGTTACTATGATGACAGTTGAA
GAGAAGCCCGACGTTACCTACGGTGATGTGGGCGGATGTAAGGAGCAGAT
TGAGAAGCTTCGTGAGGTCGTCGAACTCCCACTCTTATCTCCCGAACGAT
TTGTGAACCTCGGTATCGACCCCCCTAAAGGTATCCTTCTCTACGGCCCC
CCGGGGACTGGAAAGACACTCTGCGCACGAGCAGTTGCAAACCGTACCGA
TGCTACCTTTATCCGTGTTATCGGTTCAGAGCTTGTTCAGAAGTATGTTG
GTGAAGGGGCACGAATGGTCCGTGAGCTTTTTGAAATGGCTCGTACCAAA
AAGGCTTGCATTATCTTTTTCGACGAAGTTGATGCCATCGGAGGTGCTCG
TTTTGATGATGGCGCTGGCGGTGATAATGAGGTTCAGAGAACCATGTTGG
AGTTGATTACCCAGTTGGATGGTTTCGACCCTAGAGGAAACATCAAAGTC
ATGTTTGCAACCAACCGGCCCAGTACCCTTGATCCTGCTCTTCTCCGGCC
TGGACGTATTGATCGAAAGGTGGAGTTCAGTCTGCCAGATTTGGAAG

Sequences in the Contig:

SY0AAA13YN01FM1 SY0AAA1YF05FM1 SY0AAA21YP17FM1
SY0AAA38YI21FM1 SY0AAA42YI21FM1 SY0AAA54YE18FM1
SY0AAA58YO13FM1 SY0AAA8YN24FM1 SY0AAB46YB18FM1
SY0AAB55YM16FM1 SY0AAC30YD16FM1 SY0AAC35YK15FM1
SY0AAC50YA08FM1 SY0AAC52YH18FM1 SY0AAD28YG17FM1
SY0AAD3YG23FM1 SY0AAD52YG05FM1 SY0AAD63YP13FM1