Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1545
Length(NT) : 1713
Best Gene Model Blast : Link to GSTUMT00005518001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_10647
Accession: ref|XP_001550923.1| Score: 1043 E_value: 1e-111
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_04483 Score: 1023 E_value: 1e-109
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0752 Score: 813 E_value: 3e-87
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 243 E_value: 3e-21
Swissprot: Q12251|YP011_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1545
TTGGATCCCTTATCCCTTCCCCCCATCATATTTAGCCTGCCATAATTCCC
AAACTCCGATTCACGTTTGTCCTCCATCTGCAGCGTTGAAAACCCTCGGC
GTTGGGCAAGTTTGTTTTCTCGGCGGTTGAATGGACCAAAAAACAGCGGC
TCTTTCCTGTTCACGCTTTCCGGCTCCCCGCTTCCCATCGGAATCTTTTC
AAGGCTCCTCTCTACACCGACGTTGTCATCTTCCACAGCGCCTCAGTTGC
ATTGAACATCATCTCTCTCTATCTCCTTGCATAACCCTGTTGTCACCTGA
AATTCCCTCATCATGAGTCTCAATCGAAAACCCCCCACTCCCGTCGGTGA
TACCCCACCACTATCAAAGGACGCCGGTCTTGCTGCTTCAGAGGTGACGT
TTCCCTTCCCTTTTCACTCCTGCCTTGAAATTTCTGACTTTTCTCTTCCA
CCTTAGCCTGCTACAGCACCGACAACTTCCCCGCCTACAATGGCTTCCTC
AAAAGCTATTCCTCCACCTTCGGATTTCATGAGAGGGCTCCGTGAGTATC
TTAGTCAACCGGTGACTGCGTCGTTCATTGCCGGAGGTATTGCCGGCGCC
GTCAGCAGAACAGTCGTTAGTCCATTGGAGAGGTTGAAAATTATTTTTCA
AGTCCAGGGTCCTGGAAACAGCTCTTACCGGGGTGTCGGACCCGCACTGG
TGAAGATGTGGAGGGAAGAAGGCTGGAGAGGCTACATGAGAGGGAATGGG
ACGAATTGCATACGAATTGTACCCTACTCGGCTGTCCAGTTCTCCAGCTA
TACAATTTACAAGAGGCTCTTACTTCCAGAAGGCGGCACTGACCTCGGCA
CTCTTCGCCGACTCTGCGCCGGCGCCATGGCTGGTGTAACATCAGTTGTC
GCGACATATCCTCTCGACATTACCCGTACACGTCTTTCCGTTCAGTCAGC
TTCGTTCTCCTCCAAGGGTGTGCCGCACACCAAACTTCCAGGTATGTGGG
CAACCATGAAAACGATGTATCGTACCGAAGGCGGCACAATATCCCTCTAC
CGTGGATTAGGCCCTACCCTCGCCGGCGTTGCTCCATATGTCGGAATCAA
CTTTGCTACCTACGAAGCTATGCGGAAATTCATGACCCCTGAAGGGGAGG
CAAACCCAACGGCCCTCGGGAAACTATGCGCGGGTGCTGTTAGTGGAGCT
GTAGCCCAGAGTGTTACTTACCCCTTCGACGTATTGAGGAGAAGATTTCA
GGTCAATACAATGAATGGCCTTGGTTACCAGTACAAGAGTATATGGGACG
CAATATCAATCATCCTCCGGGCTGAAGGTATCAGGGGAATGTACAAGGGG
CTATTGCCAAACCTGCTGAAGGTGGCGCCGAGCATTGGCAGTAGTTTCTT
GAGTTTTGAAATTGCTAGAGATCTACTTGTCGCCCTAGACCCAAAGCTAA
ACATATGAACCAAGCACTTCTTGTCTTCTATTTGCTAATTACTTGATTGC
GTTCGTGGTTTCGACAAGCAAAACTCGGCCTGCGAAAAAAAATACCCTCT
CGGTATCTACGGAGGGGCTGTGTGATAGAATTGTCTTTTATATATCTTTT
TGCTAGTGTTTTTGACATTAAGGGTAATTTCATTTTTCCTCATTTATTTC
TATTTTTGCAGTCCTGCATGAATTTTGTTAGCCTATCCCTGCTCACCCTA
GTTGCTTTGGGGG

Sequences in the Contig:

SY0AAA34YJ11FM1 SY0AAA48YD22FM1 SY0AAA54YD15FM1
SY0AAB53YL15FM1 SY0AAB58YP22FM1 SY0AAC47YP11FM1