Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1544
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00009909001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: zinc metalloprotease, putative
Accession: ref|XP_001267261.1| Score: 345 E_value: 5e-31
KEGG Definition: zinc metalloprotease, putative
Accession: afm:AFUA_4G07610 Score: 337 E_value: 2e-30
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0961 Score: 209 E_value: 1e-17
PFAM Definition: No Hit Found
Swissprot: Q12496|YO098_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1544
TTGGCCGTTCTCCTGATGCTTATAGAGCATGGGAGGTGTCGAGGAAAGTG
ATAAATGACCATATAGATGGGACTGTCGCATTCAACAAACACGCTCTAGA
AGGTGCGCTCAGCGGAATAGTTGTATCGTTTGCCGATGGCGAATCCACTA
TGTCTGCTGCCGCCACCGTATCCTTCGTGAACCAGGTCGTCCATAACCGG
TCAAAGGACTATAACATGCAATTATTAAAGAAGGTGAAGGAGGTTTCAGT
GGATGATCTGAGGAGCAGTCTCAAAGAATTTTTGGTGCCGATATTCCAGT
ATGATACAAGTAACAACATAATCGTTACCGCACCGGTGAAAACTGACTCT
ATCAAAGCGGCATATGAGAAGGAAAATTTCACTGTTACGGTCAATCCCTT
GTCATTCTTCCAAGATGATTATGGATTGAAGTATGGCTTGAAAGACGGAC
AAGAGGAGGACGATGATGATATTGACGACATTGATGAGAGCGACGATGAT
GACGAAGATAGCGAAGACGAGTAAGGCCGAGCTCGCGTGAAAGGGTAGAG
GGGTAGATATACTAGAGATTTGCTAGATCCCTGGGTATGGTCATGGTCGG
ATGTGTCAACATAAACCAAAAACATAGTTGAGGGTGCTCAATTGGGCACT
ACCGAG

Sequences in the Contig:

SY0AAA54YC18FM1 SY0AAD46YF04FM1