Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1542
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00004943001 E-value : 1e-169
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_502623.1| Score: 293 E_value: 6e-25
KEGG Definition: hypothetical protein
Accession: yli:YALI0D09625g Score: 293 E_value: 3e-25
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3901 Score: 303 E_value: 1e-28
PFAM Definition: TFIID-18kDa, Transcription initiation factor IID, 18kD subunit. This family includes the Spt3 yeast transcription factors and the 18kD subunit from human transcription initiation factor IID (TFIID-18). Determination of the crystal structure reveals an atypical histone fold.
Pfam Number: pfam02269 Score: 316 E_value: 3e-30
Swissprot: O60076|TAF13_SCHPO

Sequence:
>Contig1542
CACAACGCAACGAAAAAGATGGCCACCGACGCAGGAATTCGTCGCCCGCG
TACCCGGCGTCAACATCTCTTCGTTAAAGAGCGTCAGCTTACTCCCACCC
TTCTTTACTCCCAGCTTAAGCTAATCTGGCCGTGGGACAGTCAAGTCCTT
AATGTACGCCTTCGGTGACGACCCAGACCCACTTCCGGAATCGGTTCAGG
TCCTCGATGAGATTGTCACCGATTACATTATCGATATGTGCCATGACGCG
GCAAGGATGGCTTCCAGGGGTGGGAGGAATAAGATCAAGGTGGACGACTT
CAAGTTTGCGCTCAGGAAGGATCAGAGGAAGTTGGGAAGGGTGGAGGAGC
TGTTGATTATGTCTAAGGTTATCGCCGATGCCAGGAAGCAGTTTGATGAT
AAGCAGGAGGTTAATGATATTGCGGGTACTGGGAAGTAGTGAGGAGAGGG
CGGAGGACGAGAATGGTACAAAAATTATGGGTGTATTATTATGATGAGGT
GTTTTGCGGGTTATTTCATCGTGATTTCCTTACATGAAAGGGGTTTTCTT
TTGTGGGATGACCGGTTTGTTTTTTTTGACCCTATGTACAACATACCATA
CATGCTATTATGATACAGATACAATACTCTCTCAAATCTAATTCTTTTTA
TTTCA

Sequences in the Contig:

SY0AAA54YB11FM1 SY0AAD11YC01FM1 SY0AAD42YG16FM1