Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1541
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00002904001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_07860
Accession: ref|XP_001591234.1| Score: 517 E_value: 8e-51
KEGG Definition: hypothetical protein
Accession: ang:An08g04480 Score: 445 E_value: 9e-43
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2203 Score: 233 E_value: 2e-20
PFAM Definition: RHD3, Root hair defective 3 GTP-binding protein (RHD3). This family consists of several eukaryotic root hair defective 3 like GTP-binding proteins. It has been speculated that the RHD3 protein is a member of a novel class of GTP-binding proteins that is widespread in eukaryotes and required for regulated cell enlargement. The family also contains the homologous yeast synthetic enhancement of YOP1 (SEY1) protein which is involved in membrane trafficking..
Pfam Number: pfam05879 Score: 389 E_value: 1e-38
Swissprot: Q8TGG5|SEY1_ASPFU

Sequence:
>Contig1541
TTGGCCACAGACCCTATCGAGCAGGCATACACTACTGCTCGTGAGGCAAC
ACTCGGATTGATACCTTTGATTTCCCGTATCCGCCTCGCTTCAGGAGTGG
AGCCACCATTGACCGAATTCCTCAGTGATCCGCCCTCCAACTTTGAGGAG
GATGTTGATGATATGGGCGTCGCCAAAGACGAGTTTGTGGTGCTTGGTGA
AGCTAAGCAGGTCGACTTGTCGACTAGGTTTAAAAGAATGGCAGATGCAG
TTTTCGTTGAAGCTAAGAGGAGCACTGTTAGTTCGGTGGCACAGATTCCG
ATATATTTCTGGGGCCTCATGCTCGCCTTGGGGTGGAACGAGATCTGGGC
TGTGCTACGAAGTCCTGTCTATTTTATCTTTCTGCTCATGTGCTGCGCTG
CGGCATATGTAGTCCATACCTTGAATCTCTGGGGACCAATCCTTCGGGTC
ACCAATGCTATGAGTCAGCAGGCCGTAGATATTGGAAAGGAACGCCTTCG
TGATCTTGTCGCTGATCCAAACGTGGTTTATCCTGCAGGATTGAACGGGA
CCAGAGGCGTTGATGATGGTAGCGGCGCCATTAGTCTGCAGACGTTAGAT
GGCGAAGGAAGAAAACGAGCTAGAATCAAGCGGGAAGACGACGACGAGTA
GGCCACTGGAGAGGTCCGGCGGGTGTTGGGGCATAATATTAGTGGGGCGA
GGGCTGTGCTTGGAATGCGGGTATAACTTTCTCTCAA

Sequences in the Contig:

SY0AAA54YA20FM1 SY0AAC24YH02FM1