Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1540
Length(NT) : 570
Best Gene Model Blast : Link to GSTUMT00005543001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_09129
Accession: ref|XP_001552658.1| Score: 542 E_value: 6e-54
KEGG Definition: hypothetical protein
Accession: ang:An05g00880 Score: 471 E_value: 5e-46
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0712 Score: 335 E_value: 2e-32
PFAM Definition: DnaJ, DnaJ domain. DnaJ domains (J-domains) are associated with hsp70 heat-shock system and it is thought that this domain mediates the interaction. DnaJ-domain is therefore part of a chaperone (protein folding) system. The T-antigens, although not in Prosite are confirmed as DnaJ containing domains from literature..
Pfam Number: pfam00226 Score: 265 E_value: 2e-24
Swissprot: P25303|SCJ1_YEAST
Gene Ontology:
GO:0005788 = Cellular component: endoplasmic reticulum lumen
GO:0051087 = Molecular function: chaperone binding
GO:0030433 = Biological process: ER-associated protein catabolic process
GO:0006457 = Biological process: protein folding
GO:0006986 = Biological process: response to unfolded protein

Sequence:
>Contig1540
TTGGCCTTCCTCTCCACATAACTCCGCTCGAGCTTCGATAGCACATCACC
TGTCGCTCGTTCATCGAATTTTTGGGTTCAGAGGGCGTTTAACGCCTGTT
CTCTTCTTTCCATAATGCGTCTTTTTAAAGCACTGTTCTTGCTGCTGCTA
CCAGCGGTAATGGCGCAGGATTATTATAAGTTGCTAGACATAGACAGGAA
AGCCTCAGATAGAGATATCAAACGAGCCTACCGAAAACTGTCCAAGAAAT
ACCATCCCGATAAGAACCCTGGCGACGAGACGGCGAAACAAAAGTTCGTT
GAGGTAGCCGAAGCATACGAAGCCCTTGCCGATCCCGAATCCCGCCAGAT
CTACGACCAGTACGGTGCGGAGGGACTCAAGCAGCGACAAAATGGCGGAG
GGGGCGGGGGGCACCACGATCCATTCGATCTATTTTCCCGCTTCTTTGGC
GGCGGTGGGCACTACCACCAAGGCGATCGGATGCGCAGGGGCCCAAACAT
GGAGGTCAAGGTGCACCTTCCTCTGCGCGATTTCTACAACGGCGCGGAGA
AGGAGTTCACTGTGGAAAAG

Sequences in the Contig:

SY0AAA54YA16FM1 SY0AAA63YA09FM1