Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig154
Length(NT) : 781
Best Gene Model Blast : Link to GSTUMT00005047001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001220878.1| Score: 314 E_value: 3e-27
KEGG Definition: hypothetical protein
Accession: ncr:NCU02617.1 Score: 314 E_value: 1e-27
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0379 Score: 112 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>Contig154
TTGGGCGCCATCGAAATCCCCCCTTTCCGTTTTTTCATCTTTTTCACGGC
CCCTTGTCTCTCCCTCTCTGTGTCTCTCCCTATCCTTTTCCCTTGCTCTC
TCGCTCCTCATTATTAATAATTTTTCAATCTTTCAATTCTTCCCTCTCTC
CCATCTCTATCAAACTCGCAGGGTTCTTTTTCAAACAAACCATTTCCTCA
TTCGTTCCTCCAACCCCGAACACATAGACTCTTCCTTCCTTTCCTTCTTT
TTTTTCTTTTTTTCCTTTTCTTTTTACCCCAAGAATAGCCCTGTTGAGCC
CCATGGCTTTCGTGCCCCCCACTACCCCGGCGCACCACCAGCACCAGCAC
CACCAAGTGCAGCAGAACCAGCATCAGGGCATATACGCTTCTGGTGGTGC
CTCGTCGAATACTTCCTTCAATACCCCTCCTTCACAGATTATGTCAGGAG
CGGGTGTGATACAGCAGCTGGACAAGAGCGGATTACTACTAGGGAGGAAG
AGAGCATTGGATGGTGGGAGTATCGAGGATACGGAAGGGGCCGCTTACAG
GCCTGCGGCTTATAGGACTGAAGGTGCCCGCCTTGCTTGCCTGGTCAACG
CTTCTGTCACGGTGTGCGGGGAAGATGCGATTTACGCCTTTGGCGGATTC
GATCAGTATACCGATGAAGTATACAATCATGTGCTCAGATTGGATCTGCG
CACTTACACGTGGACTCTCGTTGATAACTACGGTGACATTCCTAGTGTTA
GGATGGGTCACACAACGGTCTATTGGCGTGA

Sequences in the Contig:

SY0AAA15YK17FM1 SY0AAA33YM10FM1 SY0AAB9YE13FM1
SY0AAC39YD01FM1