Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1539
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00007731001 E-value : 1e-104
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1539
TTATAATGCCAACTTTGTACAAAAAAGTTGGCGCTTTGTTCACAGGTGCT
TGCTTCTTTATCTTCTATTCTCCGAGATCTGATTTCTGCCTCCCTCCATC
TCTTGCATCCTCGCGACGTACGCCCTACCATCAATTGAACCCTCGTCATC
ATCCCAGGCAAGAGAGAGAGCCTCAGCAACCACGGCAAGCCATTATGCAG
AACTCCTCCCGGACTGAGCCTCCTGAGCCAATCCTCTTCCCTGCTCTCAA
GGCAGGTGCAGTGGCCGGACTTGCTGGTACACTTGCCGGAGGGGTTATTG
GCATTCTTCGGTCGACCCCACATGCTAAGACGTTCGCCGTACTTACGGGC
GCAAACACTTTTGTACTTGGTTGGACCTATTGGGGTGTGTGATCATTCTG
GTTGGATTTTGAGGTTGATAATTGAAAAACATTGGTTGGTACCTAATGGA
CTCGACAGCTGTCAGATCGACAATGTGTCGTGCCATTTACGATGCTTCCC
CGCCTGGTACAGCAATGGTACCCAGGGACAGAGTCCTTATTAGCGGGGCT
TCGGGGGCTATTGCTGGCGGTTTTCTTGGGATAATATTGCGTACGAGGAC
CCGATCTTTGAATCTGGTCTTAGCGGCAAACTCACGATGAATTCGCATTA
ACATTTTCCTTTGTTTTTTATTGATCATAGG

Sequences in the Contig:

SY0AAA36YO07FM1 SY0AAA54YA10FM1 SY0AAA59YP21FM1