Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1538
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00006234001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_14920
Accession: ref|XP_001546571.1| Score: 693 E_value: 3e-71
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00856 Score: 682 E_value: 2e-70
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4091 Score: 126 E_value: 4e-08
PFAM Definition: CP2, CP2 transcription factor. This family represents a conserved region in the CP2 transcription factor family..
Pfam Number: pfam04516 Score: 145 E_value: 2e-10
Swissprot: Q5FWH3|GRHL3_MOUSE
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003677 = Molecular function: DNA binding
GO:0005515 = Molecular function: protein binding
GO:0008544 = Biological process: epidermis development
GO:0007389 = Biological process: pattern specification process
GO:0045941 = Biological process: positive regulation of transcription
GO:0042060 = Biological process: wound healing

Sequence:
>Contig1538
TTGGGAGACCGGCGTCGTGTTGGCAACTATGGAAGGAAGGTCGAGGAACC
AATGAAGCTCACCAGCGTGGCGGAAAACTGCAAGCCGTTGAGTATGTTGA
AGCGTCTTCACAGCCCGAGGATGACAAGAAGAAAGGGAGGGTCGACATTG
AGACAGCATCGTTCGACAGTTTCGCGGTTATATGGTCTCCTCCCCCTTCT
GGTTCTCCCGAGGCCTCTGTATCGGTACGGTTCAACTTCCTTTCTACGGA
CTTTAGCCATTCGAAAGGTGTGAAGGGCATTCCTGTGAGATTGTGTGCCA
AGACCGAGGTTTTGTCGTCGGGTTCACCACAATCCCCGCCCGAACAGCCA
GAGATCTGCTTCTGTAAGGTTAAGCTTTTCCGGGACCATGGAGCGGAAAG
GAAGTTGGCCAATGACATTCTACATGTTAAGAAGACTATTGAGAAACTTA
AGCAGCAAGCAAATCAGGTTGAGGGGACGGGCATGAAAGCGTTAGGCAAG
AAAGGCAAGAAGGATGAGGATTCGGGAAAGCCCGGAAAGGCACTAAAGCA
TAAGCGGACGTGGTCAATGTCTTCTGCGAGTTCTGTTGGTGGAGTAAGGG
CTCATGAAGAGGATACCAATGCCAAGCTGGCCAGTATGCAGGACATGTTC
ACTAGCACACGGGCCGTCAGTGTGTTATATCTT

Sequences in the Contig:

SY0AAA54YA09FM1 SY0AAC38YK17FM1