Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1537
Length(NT) : 530
Best Gene Model Blast : Link to GSTUMT00005906001 E-value : 1e-105
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_06363
Accession: ref|XP_001242467.1| Score: 366 E_value: 1e-33
KEGG Definition: hypothetical protein
Accession: ani:AN8860.2 Score: 348 E_value: 7e-32
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3347 Score: 310 E_value: 1e-29
PFAM Definition: No Hit Found
Swissprot: Q8TG40|HBR1_CANAL

Sequence:
>Contig1537
TTGGCCAAACCCCACCCCCCACCAAACAAAATAAACCCAAATAAAGCAAA
ACAGCACCAGATCAAACCAAGGCCAAAACGAAAACAAAAACTGAGGCCTG
CACCCGCCAGAATCAAAGACACATCTCACCATGCCTCGTACAAAGCCAAA
CATCATAATCACCGGCACGCCCGGCGTCGGTAAATCTTGCCACTGCGAGC
ACCTAGCACAAATCACAGAACTGGGTCTCAAACACCTCTCCATCAACCAT
ATTGCCAAGGAGCGCAACTGCTATGACGGTTATGATGACGAACTAAAAAG
CCATATGATCGACGAAGATAAGGTTTGTTTTCCGGCTTGCCTTTTTATTT
ATATTTTTCCTTCGTTCCGGATATCCGCGCTTTCCCGAAGCTAAATATAA
GGGGGTGTTTGGTTGGTTGCTCAGCTTCTGGACGAAATCGAGGACGAGGT
TAAGGAGGGCGGGTACATCATTGATTGGCACGTATGTGATTTGTTCCCGA
AGAGCTGGATAGATCTTGTTGTTGTGCTAC

Sequences in the Contig:

SY0AAA54YA07FM1 SY0AAA63YI11FM1