Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1536
Length(NT) : 984
Best Gene Model Blast : Link to GSTUMT00000073001 E-value : 1e-106
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An07g04240
Accession: ref|XP_001391506.1| Score: 288 E_value: 5e-24
KEGG Definition: hypothetical protein
Accession: ang:An07g04240 Score: 288 E_value: 2e-24
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0395 Score: 245 E_value: 1e-21
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 213 E_value: 6e-18
Swissprot: P08645|RAS3_DROME
Gene Ontology:
GO:0005811 = Cellular component: lipid particle
GO:0007155 = Biological process: cell adhesion
GO:0007391 = Biological process: dorsal closure
GO:0035099 = Biological process: hemocyte migration
GO:0030713 = Biological process: ovarian follicle cell stalk formation
GO:0016476 = Biological process: regulation of embryonic cell shape
GO:0006930 = Biological process: substrate-bound cell migration, cell extension

Sequence:
>Contig1536
TTGGGCTGAGACGCTGTTGTGGTAGCGAACGCTCTGCTCGCTCATGTCTA
GCTTAACTTAGTTTTTCTTACCTAAACTTAACTCGCCTCAGCATCTCACA
TTGCCCGCACCTACCCACCTGCCTGCTTACCAGACCCTCTTCACTTCACC
TTCTCGCCCCTTCCTCGTTCACAAACTATCGTAACTTCACCATCTTCCCA
TCACCAGCACTCACTACCTACTTACCGAACTCACATCACCACTCTCAACC
TACCTCCGACTCACTCGCTCACCCACCCACTCACTCACTCACCATCGCCC
GAAAACAACAGGGCGGGTTGCTATAACCAAACCAACCATTATCTATGCAG
CACAGCAGAAGACGAGAGTATCATATTGTGATTCTTGGAGCTGGCGGTGT
TGGGAAGAGCTGTTTGACATCGCAATTCGTACACAACGAGTGGATCGAGT
ATTACGATCCCACAATTGAGGATGTTTACAGGAAGGTCATCGATGTTGAT
GGACGGTCGTGTATTCTTGAGATTTTGGATACTGCTGGGACTGAACAATT
TAGTTAGTGGCCTTTTCCTCTTGATTTTTTTCTTCTGCTGTTCTCCTCTC
CCCCACGGGATTGTGTGTGATTGATGGATGGACGGTGGATGGTAGATGAG
GGTGATATTGTTGGGATCAAAGTTGTTTTTTTTCTAACGGGTTTGCTGGG
AATTGTGAGTAATAGCCGCCATGAGGTGAGGTTTTTTTCCTCTTCACTTT
CTCTTACACACACTCTCTCGATTGCTTCCCCTGATGTGTATTTTGACTGA
CGATTGTTAGGGAAATTTACATGAAAGCTGGTACATATAACCTCACCCCC
CCCCTCCCTCTCTGCCTCTCGAGTCAGACCCTTTCTCTATCATAACTAAC
CCTCGGCACAAAATTTTATCCTATAATCAACAGGTCAGGGCTTCCTCCTA
GTATACTCAATCACAAGCCTGAGCACCCTCACAG

Sequences in the Contig:

SY0AAA36YG16FM1 SY0AAA53YP13FM1 SY0AAB43YB09FM1
SY0AAB58YH12FM1