Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1535
Length(NT) : 1505
Best Gene Model Blast : Link to GSTUMT00006513001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0670 Score: 123 E_value: 2e-07
PFAM Definition: No Hit Found

Sequence:
>Contig1535
TTGGCCTCTCTGAACAAGTGTGCATAAAGGAAACAAATACATCTACATAT
CAATTGCCTCCCTCCCCACCTCCTTCTTCGTCCCTTCCCTTTTTTTCCCT
TTCTTTCTCTCTTCCTCTCTCTTCGATTCTCTTCCCGAGTGTATTATTCA
CCTTTGCGCTATTTCGACCGACCCTACTTGGCCATTCGGCGGGAGAAGCG
GTTATAGACGTTTGCATGGCTCGCGACAAGGCAGGGTCTCCTTGGAGTGA
CGCAGAGAAGCTACATCTTTTGTTAGAAATCGCGAAACAGAATACGAGTC
CTAACTGGCGCATTATCGAAGTCCCTACAGGGCGGACAAAATCCCAAGCA
CAGGCAATCTTCACGACAATGAAATCGCATAGCACCCCACCCCCTCCGCA
AGGTAACAAGAAGCGTGCGAGGGAGGAACCGGGGTACGAGCAAGCGAGTA
CCCCAACCGCGGGACAAAGCAGCTCCACCACGATGATGCCCGTGCCCATA
ACCAAACGAAAGCGCGGCCGTCCTACTAAGGCCGAGACAGAAGCTAGGAA
GGCAGCAGAGGCAAGGGGGGAAATACTGCCCAAGCCGAAACCTTACATTC
CCAAGACTACAAGCAACGTGATCGTCGGGCCGGACGGTCAGATTAGGAGG
AGGAGGGGAAGGCCCACGAAAGCCGAAACTGAAGCTAAGAAGGCGCGGGA
AAGGGACTTAAAGAAGAAGCAGGGCGGCGGAGATGATGATGAGGATGATG
ACAAGGTGAGGCAGCAATTGGGACAGAGCGAGCAGAGCGAATTGGCCGAC
GACGATGACGACGACGATGTGGAGGAGGATGAATGATCTCTCCGGAGAAA
AACGGGTGAGAAAAGGAAAAAGAAATCGAACCAACAAAAAAAAAAAAAAG
AAAGACCAGGGGAGATGAGGTTCCTATCATTCCTTGCCGGATCTCCTTAC
GCGCTGTTATTCGAGATTGATGGAATATGAGGATGGGGGGGTGGAAGGTG
GGGTGAAACATCGGATGAACTGTACGAAAAGAAATGTTTGAAATGGCAAC
AAAAGAGATGCGGGTCGACTCGTTTTTCCCCTCTTCAGCAGCCTTCGCTC
CGCTCATGGTTAAGTTTGAATGGACGTTTGTGGAACAGGGCATACTGGGG
AAACGTTTACAATCGCGCAATTATGGTTAAGGGAGTTTTTTTTTCTTTCC
TAATATTCGTTTTTGCTTTGTTTGCTTATGTCTCGTTTTTAATTATGTAT
TCTACGGGGGGGATTCGTGATTTGATGCTTGTTATGCTTTTATCCTTTCC
TCCAATGAGCGGGAAGACATTTGTTTCCTCTCAAACGTATTCATGTGCCG
AAGGAAGGGAAGAAGGATTGGGTTGGCCTTTTGTCATTACTATTATCGTT
TTTCTTTCAAGTATTCCAGGATAGGTTTTATTGACTTATTTTATTCTCTT
CTTGACAATGTGTTTTTTGTCGCACAAGTTTAAGTTTAGTTGATTAGTTA
CTAGC

Sequences in the Contig:

SY0AAA17YP23FM1 SY0AAA42YI13FM1 SY0AAA53YP03FM1
SY0AAA62YE18FM1 SY0AAB21YA02FM1 SY0AAB26YJ18FM1
SY0AAB37YB14FM1 SY0AAB43YC19FM1 SY0AAB48YN12FM1
SY0AAB53YA21FM1 SY0AAB59YH15FM1 SY0AAB60YG13FM1