Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1534
Length(NT) : 913
Best Gene Model Blast : Link to GSTUMT00006794001 E-value : 7e-07
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1534
TTGGAAACATCCACACGGCAAAGGCGTGAAGGCAAGCAAGCCCTCGATAA
ACTGCTTGGAATTGAATTTGCGGCCAGCGCATCCCCTCAAGCTGTCCTCT
GTACTCTGCTGACAGCTAGGTTATGCTTCGTCCACCCGCTTCACTTGCCC
ATCCACCACATTCCGCCAACGTTTTACCACTGCTACGTTTGCTACCGCTT
CAAACGACCTTTTTCCTAGGCTGGCTATCGCTTGATCGTCGTTGACGAGA
CCACGACCTCTCTTTTTTGTTCCTCTCACTAGGTATTCCATTAAGGACCG
GCCCTGCTAGTTTACTATTCTGATTCCTCCACTCCTCCCTCTCCCCCTCT
AACACTTTCACTCTTTCTTCCCTTTACGATAGGTTATGTGAAACGACACT
GGTCTCTACAACAGCTCTTATTCCACGCACACGCAAACGCATACACACCT
CTCCCCTGAATCAAAAATTATCGAATAACTCACGAATTCACGAATCCACA
GCCTGGCCGTTCTGGGTAGGAAGGGGCTATTTGTTGCGGTTGTCCCTGGT
TTGGCCTATTTGCTTTTTTTCCCAGTTCCTATTTTTCCTTTTCCATCCCC
CCTCCCCACGTTTTGTGGTGCATACAAGTGATCTCACCGAAAAGGGAAAG
CGTAGGGCTTCAGCTGCTGAGCAACATCAGAGAACGAAGGGCTGGGTTAG
AGTTTGGGCCACACTTGCCTGTGTGTCATCCGGGTCAGGTAAGCAGCGCC
TTTTAGAGGATAGATAAATACCTCCGGCTCAACCCCCCTTCATTCCGGCC
GCATTACCCTCTCCCGCGTACATAGACACTCCTACGACTTGGACGTTTGC
ATACCGTTACGAAGAATCATTGTTATTACGAACACGATGCGTGCCATAGT
ATTTCGGTTCGTA

Sequences in the Contig:

SY0AAA39YF18FM1 SY0AAA53YO11FM1 SY0AAB45YK16FM1
SY0AAB48YC06FM1