Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1533
Length(NT) : 879
Best Gene Model Blast : Link to GSTUMT00009176001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56416.1| Score: 1255 E_value: 1e-136
KEGG Definition: peroxisome assembly factor 2 containing the AAA+-type ATPase domain
Accession: aor:AO090005001500 Score: 1255 E_value: 1e-136
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0736 Score: 1107 E_value: 1e-121
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 520 E_value: 1e-53
Swissprot: Q7SGP2|PEX6_NEUCR

Sequence:
>Contig1533
TTGGGTAGGAGGTCTCGCAAATGTAAAGAGCGCCGTCATGGAAACAATCC
AACTCCCACTCGAGCGACCAGAACTCTTCGCAAAGGGGATGAAGAAGCGT
TCCGGAATATTATTCTACGGACCTCCCGGAACTGGAAAAACGCTACTGGC
AAAGGCGATTGCCACGGAATTCTCCCTCAATTTCTTTTCCATCAAGGGGC
CTGAACTACTGAATATGTACATCGGTGAGTCGGAAGCGAACGTCCGAAGA
GTTTTCCAGCGCGCCAGGGACGCACGACCTTGCGTTGTCTTCTTCGACGA
ATTAGACTCAGTCGCGCCGAAAAGAGGGAATCAGGGTGATTCCGGGGGTG
TCATGGACAGGATTGTTTCCCAGCTGCTCGCAGAATTAGATGGCATGAGT
GAAGGTGCGGAGGGTAGCGGCGGCGTATTCGTTATCGGAGCGACCAACCG
ACCGGATTTACTCGACGCAGCATTACTACGGCCCGGGAGGTTCGACAAGA
TGTTGTACTTGGGTGTTTCGGACACTCACGATAAACAATTGACTATCATG
GAGGCCCTTACTAGAAAATTCACCCTCTCCCCAACCCTCTCTCTCCGCAG
CATATCCGAAACTCTCCCCTTCACCTACACAGGAGCAGACCTGTACGCCC
TCTGCTCCGACGCAATGCTCAAGGCAATCACACGCCAAGCCAACCTCGTC
GACGAAAAAATCAAGCGCTTGTCGGCCACCTCGGAGGAACCCGTTTCAAC
AGCACACTTCTTCGACAACATCGCTACGCCTGAAGACGTTCTCGTCGTAG
TTGGTGAGGAGGACTTTTTACAGGCGAAGGGCGAATTAGTCGGTAGTGTT
AGCGCCAAGGAGTTGGAGCACTACCAGAG

Sequences in the Contig:

SY0AAA53YO07FM1 SY0AAD48YK24FM1