Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1532
Length(NT) : 1058
Best Gene Model Blast : Link to GSTUMT00002939001 E-value : 0.0
Numbers of ESTs : 34

Blast Results:

Nr Definition: hypothetical protein CC1G_09155
Accession: gb|EAU81969.1| Score: 367 E_value: 4e-33
KEGG Definition: hypothetical protein
Accession: ani:AN6273.2 Score: 330 E_value: 3e-29
KOG Definition: No Hit Found
PFAM Definition: Cerato-platanin, Cerato-platanin. This family contains a number of fungal cerato-platanin phytotoxic proteins approximately 150 residues long. Cerato-platanin contains four cysteine residues that form two disulphide bonds..
Pfam Number: pfam07249 Score: 342 E_value: 6e-33
Swissprot: Q1E8D2|AG19_COCIM

Sequence:
>Contig1532
TTGGACTTCGAGGCCCGGAGGTGAACCTGAGTAATATCTCCAGATCCCTG
GAGATGGGGAGGAGGGAGCAGCTTCTGTTGAGAAGAGAGAGATATATAAA
CTGTTAGCATCATCCACGAAATTCCACAGCCATCATCCGGCGTCTGAGTT
TTGTCGATTCTCTCTCGCTATTGTATCATCACCAAGATCACTCGTTTTCT
TTTTTCAGCTCGAAAAACAAAGTACCCGCCGCACGGCCTACACCATATCA
CTCCAATAGGGAAACCACGAAAAGTTTAAAGAAAGAAGAAAAAATGCAAT
TCCTAAAGACGATCCTCCTCCTCGCTTCCACCCTAACCCTCACCCTAGCA
CAAAGCGCGGGTGTGGCCAAATACGACACCACCTACGACAGCGCCAGCCT
CTCGACGCTCTCGGTAGCCTGCAGCGATGGTGCGAACGGGCTCTACACGA
AGGGCTACCATACCCTAGGAAGCGTTCCCGGCTTCCCCAACCTGGGGGGA
TCGGGCACCATCCCGGGATGGAACTCACCGAATTGTGGTGCCTGTTACGA
GTTGACGTACACGCCTCCTGCGCCCGCCGCTCCCAAGGTCCTCAACATCG
TCGGTGTGGACGTGGCGGCCCCCGGTACGTTTGTCCTGTCGCGGACCGCT
CTGGACACCCTGACGGGTGGGCAGGCAGTCCCGCTCGGACGTGTGAACGT
GACCTGGAGACCGGTAGCAGCGAGTGTGTGCGGGTTTCCATGAGTCGTGT
GAGCTCCCTTTGTTGGTAGGCTCTGGGGGGAGGGGACGACGACTGGATAG
TGTATCCTGGATTTTGCGCAGACGTTTTAGGAGGTAGTTTGGGGTTTGAT
TGATTTGTTGGTTCTTTGTTTTTGAGGCTTAGGGTGGAACATCTCGGTCG
GGACTTGACGGAGTAATGCACAAGATTAATTCATCCTGGCTTCACTCGTC
TCATGAGTACCGCTTGGTGGCGATGTGGTTCTGGATGTCGTTGTTCAAGT
ATGGTTGGTGAAGTCAAAAAAAAAAGTGTTGAGGGATGGATGGAAATGCA
GGAGCCAA

Sequences in the Contig:

SY0AAA12YC17FM1 SY0AAA13YI05FM1 SY0AAA15YO10FM1
SY0AAA18YA19FM1 SY0AAA19YD02FM1 SY0AAA1YB22FM1
SY0AAA32YO14FM1 SY0AAA32YO14RM1 SY0AAA33YN04FM1
SY0AAA36YJ17FM1 SY0AAA49YD20FM1 SY0AAA53YN24FM1
SY0AAA57YJ21FM1 SY0AAA58YK03FM1 SY0AAA63YN17FM1
SY0AAB10YE15FM1 SY0AAB18YG21FM1 SY0AAB20YG07FM1
SY0AAB25YH23FM1 SY0AAB35YF02FM1 SY0AAB35YI24FM1
SY0AAB35YK10FM1 SY0AAB36YG17FM1 SY0AAB3YM20FM1
SY0AAB49YJ09FM1 SY0AAB53YD17FM1 SY0AAB54YG24FM1
SY0AAB55YO23FM1 SY0AAB55YP13FM1 SY0AAB56YK12FM1
SY0AAB59YJ09FM1 SY0AAB60YK22FM1 SY0AAB61YC14FM1
SY0AAD46YL07FM1