Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1531
Length(NT) : 1623
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1531
TTGGTGCTAGGCTACCTCGGGGGATGAGCTGAGACTCGGGATTTCTGTTG
ATATGCTGAGCCCCTAATCAGAGAGAAATCCCCTCAATCGGGAGCCTTGA
GGGAAGCTGCGGCCGATCCTTAAAGTCTGCCGGCTCATATCGTACGATAA
TCTATTGTGAGGTTTGCACTGGTACGTGAGTTCATACAAGACCCAGACTC
CGCCTCTTTTCGGTTTCCCACCTCTGCCACGCGAATCCGATCAATGGCGG
AATAAACCCCCTCTTTTCAGTTGTACCTACTACTTTGAACAGAGAACCTC
AGACTTGTCATGACTATGAGCACGGCGAAGCCTCTTTCTTCCGGAGTATA
CCTTAGTTAGGTGCATAGTACCTAGCGTAGGAAAGAGGGGAAAAAAACAT
TGTTTATTCCCCTTTTTTACCACTAAAGGCGTGCGTATCTGTGGCCCTCA
AAGTCTCTGGCGTGCAAGGCACACTTTGGTCCATCACCAAGTTTTGAGCC
TGGGCATCTCTCCATTATTTACGCTGTGGCGGTTGGGGCGTACATAACGC
ATGACTCGAAAGCCAACACAAAAAGAATCGCCTGGTTGATCTCTCTCTAA
TTGAAATGAAAGGGAACAGTGATTCAGAATTTACTTCTGCGCACGCCGTT
GTGCTCTTAGAATTTTGTGATATTCTGACGGTCTTTTGCTATCGGAACCT
CATTTAGTCGGCGGCGGGCCTGAAATCGGAGGGGCATTTGGGGGGCCCGG
AGGTTGCTGTGGGGAATTCGGTACCGGAGGGTTACCAATGCAGTTTCGCT
GAAACACCGCCAAGTGACAGAAGAGGCTCAAGTATCAACACCGGCACCCA
CGCACAAGGGCACTTTGAACTCATACCATAACCCACCAACTCGTCTGATT
TTTCGTCTCAGTGCCACCTGGTGAGGCTTCCTTCCGAGTGCGCTTGCAAC
CTCCACGGACTCTGATAGCTTCCAGTACACCTGAGGTGCTAACTCGGGAA
GACAAAATGGACAATTTTCAACTTCCCAGATTATGACGTCGGACGGAGCT
GTTGCGGGGGGTGATGGGGCAGTGGGGTAGCTTGGATTTTGTGCCCCATC
TTGTGCGAGAGTAGTGCACCTTCTAGGCCCTGGGATACGTTCTATGGGAG
GATGCTGGGCGCTGGGTGGGATCTGGCACTTATGTTGTCTCCCATCTTGC
TGCTTGATTGCTGCAGGTACCGGTCGTTGAAAAATGCACAGCGTGGTGGG
GCGGAGGCATATGATTAGGGCTACACTGTGTGTGGTGGTGCGGTCTCAGC
ACAGCGGTGGTTAGGCAACAGAAACTGTTTGTACCTGCGCCGTGACAAGC
CTTAATCTTCCTGTGAACATGAAATCATAAATGAGACCTAAGGGGAGTGC
TTTTCTACCACTTATCGCGTTGTCCAACCTTACCACTGCCCGCGAACCTA
CGGCGGCCACCCCGCGGTAATGTGGTCCGTCTTATGGATGTTGGTTTCGC
ACCGGGTTCGGTATCGCGCACTTAATTGTGGGAGATGAGAGATTATGGCG
GTGTATCAGCATTGGTGCTTTGGGATTTGGGAAATGTAGCCTTACGGTCT
TCATACACCCTAGGTTCTACTCT

Sequences in the Contig:

SY0AAA53YN10FM1 SY0AAB58YL15FM1 SY0AAC15YE05FM1
SY0AAC50YP08FM1