Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1530
Length(NT) : 1200
Best Gene Model Blast : Link to GSTUMT00004113001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN0375.2
Accession: ref|XP_657979.1| Score: 922 E_value: 1e-121
KEGG Definition: hypothetical protein
Accession: ani:AN0375.2 Score: 922 E_value: 1e-122
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 575 E_value: 8e-60
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 259 E_value: 3e-23
Swissprot: P53322|TNA1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0015663 = Molecular function: nicotinamide mononucleotide transmembrane transporter activity
GO:0015890 = Biological process: nicotinamide mononucleotide transport

Sequence:
>Contig1530
TTGGCTCTCCTGCCTCAGGCCACAACGCAGATCTCCACCATGGCAGAATA
CAGTGCCAAAACCGCGTCACTAGAGGCTAAAGACAGGAACGGAGACTACT
TCGAAGAAGCAGATCCAGACTCAGGATTAAGCGATGCTGAGAGGAAAGCT
ATTGATAAAAAACTCGTTCGGAAGTTGGACATGAGGCTTATTCCCTGGTT
ATGTCTTCTGTTGACTAAAGAGGAGGCTTTTAAGGAACCAATATTGGCAA
CGCCAAAATCGAAGGACTTGTCGACGATCTTGGAATGACGAGCGGGCAGT
ATAATGCCTGTCTTACCATTTTTTTTGTGTCGTACGCTCTCTTCGAACCA
ATCTCGAATATCTTGTTGAAGCGAATGAGGCCGAGAATCTATATCCCATT
GATTATGGTGCTCTGGGGGATTTGTATGACTTTCATGGGGTTTTGTCGTA
ATTTTTCGTAGATGATGGCTGCTAGATGGTTTATTCCCCGATACGAGAAC
TCGTTTTTGGGATTGACTGAGGCTGGACTTTTCCCAGGAGTTAACTACTA
CCTATCCTGCTGGTATAAACGCCGAGAATTTGGTATCCGTGCCGCAATCT
TCTTCTCTGCTGCTGCCGTCTCCGGATCCTTCGGCGGTCTCCTCGCAGCC
GCTATATCTAAAATGGACGGAGTAGGCGGTAAGCGCGGTTGGGCCTGGAT
CTTCATCCTCGAAGGCCTCGCAACAGCCCTCATAGGGATAATTTCCTTCT
GGGTAGTAGTGGATTTCCCGGACGACGCCAAATTTCTCTCTCCCGAAGAC
CGCGCGAGGGTCCTCCGCCGTCTCCGTGACGATCAACAATCCTCAGCAGA
ACACGAAGATTTCAAAACGCTCTACCTCTGGCAATCCCTCAAAGATTGGA
AAACCTACACGGGGATGCTGATATACATGGGCGTCGATGGAGCCCTCTAC
GCATTCAGTCTTTTCTTGCCTTCCATTATCAAAGAGATGGGGTACTCGGC
CACGCGTGGCGCAGCTGCTCAGCGTGCCGCCGTATGCTGCCGCTTGCATT
TTGACTATTCTGGTTGGTTGGCGGGCTGATAGGAATAACCGTCGTGGGGT
GTTTAATATCGCTACTTCACTGCTGGGTGTTGCGGGGTTCAGCATTCTCC
TGGGGTCGAATTCCGCCGCGCTGAGTTACGTCGCTGTTTTCTTGGGTGCC

Sequences in the Contig:

SY0AAA53YM18FM1 SY0AAA55YK13FM1