Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig153
Length(NT) : 1275
Best Gene Model Blast : Link to GSTUMT00007215001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 355 E_value: 2e-38
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 355 E_value: 8e-39
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig153
TTGGCACCGAATTTTATAAACTTCCGCGATACCGCAACAAATTGTTTCGC
TACTTCTATAACCAGCCGACACTCCTGATAGAATATCATGGCCCAGACTA
CATTTATCACTATCGGCGACGGGAATGCCCACGGTGGCAACATAATAGGC
AGCTTCAACGAAAGCAAGACCGTATATAAGTCGGACGAGGACGCACAGAT
CATGCGTTGGCTCTCACCACTGGAGCCAAATGTCAGACATGAGGGCGTGC
GTACTGACCGATTTGACGGTGTCGGTGATTGGCTTTTGGAAATTGGCGAG
TTTCGGGAGTGGAGAGGAGGTGAGGGTGGAGTTGATAAGGCAGTCTTGTT
TTGTAGTGGGAATCCTGGAGTGGGGAAGACGTACTTGAGTTCGCTGGTGA
TCGACAACCTTTGTGATCATGCGAGGAAGGGGGATATCGCCGTCGCTGGC
TTATACTGCGACTTCCTTGCTCAACAAGAACAGACAATCACCAACCTTAT
GGGAGCTATCTTGAAGCAGTTAGTGGGCAGAGGAGACATCCCGAAGTATC
TCCGCGAGGCGTTTCAAGAAGGAAAGACGGAGCTTGGTGGCAGAAGGCTG
CGGCTTCCCGATCTGATGGGAATGCTGAGGACCACGATTGCTTCGCTACC
CCAAGTTTTCATCTGTATTGATGCGCTTGACGAATGCTTACCGAAGAATC
TTCCGGAACTTCTCAAGTCACTTCGCGATATTGTTCAGGAGTCCCCTAGG
ACACGAATATTCCTTACCGGGAGACCCCATGTCAGAGAAGAGATTCAAAG
ATATTTTAACAAGGCAGTTGTGATACCCATCAGCCCTACCACAAATGATA
TTAGGAGTTATGTGGAGATGAGGTTGGATGGGGACACCGATCCGGAGGCT
ATGAACGATGATTTACGGGCGGATATTATTGGAACTATCCTGGAAAAGAT
ATCCGATATGTAAGGGCATTTATCATTTCCACTCTATGGTTCGCTGGTAC
TCACCCACGATCGTGTGCAGATTCCTCCTTGTTTCCCTAAACCTCGATGC
TATTCTAGGAGAGGTGACAATTCGTCAGAGAAAGAAGAAACTTGAAGAGA
TGGCCAAGGGCAATGGACTGAGCGATGCCTACACGGCAACCCTAACCCGA
ATGAAGGCGCAGAAGGGAAACAGGCCAATACTCGGACTGAAGGTCCTCAT
GTGGGTACTGTATTCTGAACGGCCATTACGGGCCGCGGAGCTCTGTCATG
CCTCGGGAGTGGAGGTGGGATCTAC

Sequences in the Contig:

SY0AAA15YK05FM1 SY0AAA3YH22FM1 SY0AAB37YM10FM1
SY0AAC58YF04FM1