Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1529
Length(NT) : 2688
Best Gene Model Blast : Link to GSTUMT00006739001 E-value : 0.0
Numbers of ESTs : 52

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 789 E_value: 1e-81
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 736 E_value: 9e-76
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 113 E_value: 8e-06
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1529
TTGGCCTTCTCCTACCCTTTCCTCACTTCGCTAAGAATCATCACTGCGAG
CATCAAAGAACACATTCAGTTCCTACGTCGACAAAACACAACTTTTCGCA
ACCAAAGAATCATTCGATAAGATGAGTAACCAAAGGTTTATTACTCGTTT
CGAGGACGTCCATTCACGCCAACGCCCGGTTGGCCGGCGTTCGAGGGGAT
TATAGCGGCAACATTGGCTCTCACAACATCGCTGGCTCTGGCAACTTCAC
CGCCTCTGGACGTACTACGAACTACGGTCACATTACGAACCACGGCATCA
CCACCAACAATTACTTCACCGACACAAACTCCGGCTCGAGCGGTGCCGAA
ATTCTGCGAACCTTATACACCTCGAGATACCAGTCACACCTGGCTCGCGT
TCGTGAGCCAGCGGCGGGAACTTGCACTTGGGTTACAAAACATCCAAGGT
ATAAGGAATGGTTGAGAAGGAAGACAACAGCTCTCCTCTGGCTATCGGCA
GACCCGGGTTGCGGAAAATCTGTCATTGCCGCATTCCTCGTAAACCATCT
GAAGCTCCACGGGGACGCCATCGTTTGCTATTTCTTTTTCAAGGACGACA
ACGAGGAGCAGAGGAGCCCGACATTTGCTCTTTGCGCCATCCTGCACCAG
CTTTTCGCCCAGAGGAACTCACTTTGCAAGTACGCGAAAAAGGCGTTTAA
GGCACAGGGAAAGAGGTTGACCGAAGAGATGGATACATTGTGGGATATTT
TGGTTAAGGCAGTGGCCGAGGGGGGGTGTGGCAAGGTAATTTGTGTGGTG
GACGCGTTGGATGAGTGCGATGAAGGGGCCCTAGCTCAGTTCACCCATCG
CATTACCAGTCTCCCGAGGTCAAAGACTCCAAATATACAGTTGAAATTCT
TTGTTACAGGCCGCCCATACCACAGAATCGAGAGACAGCTTGGCCCACGG
ACAAAGACGATCCGGCTTAGGGGGGAAGACGAAGTCAGAGCTATGACTGC
CGACGTGACTCGTGTTATCAATGAGGGAATTCATGACCTAGAGTCTATCT
GGAGGCGACCCGGAAGGTTTGGATACTTGCGAAAGATCCTCGTATCTTCC
GCTGGTGGGACATTCCTTTGGGTTTCTCTTATGCTGGAGATTTTAAACGC
TAGTGTGGATGACTCTCGAGAGACTTTTACTACCCTTGTCTCCACTGCTC
CTCGAGATTTACCGCTATTATACACCAGCATTCTCAATAAAAGCCCAGAC
CCCAAACGCGCTCGCCGGATCCTGCACATTGTGGTCGCAGCTGCTAGGCC
CCTTACACTATGCGAAATGAATGTGGCATTCAGAATCAGGCGGGGCCACA
CCACTATGAGGGACATCGGAGATCTTTCCCCCAGAAGTGGGAGGACGGTG
AAAAATTTGTGCGGGCTCTTCGTACGGATTATCGATTCAAAGGTCTACCT
AGTTCACCAAACGGCTAGGGAGTTCCTGATTCAAGGCAACTCGGCCGGTC
GGGGGGAGTGGCAACATACCCTTCGTTCAATGGATTCAAACTTTATTCTA
GCCGATATCTGTATATCCTATCTTTCACTACAAGACTTCGGAAGTCGCCC
ATTATCAATGGATTCCCCGAATACCCACAAGAGAGCTAGGGAGGAGGGGG
TCCGCAATTTTTTCCAACACTATGCGTTTCTCGAATACGCAGCTAGCCAT
TGGGCTAGCCACTTCCGAGATTCGCAGAATCGGCAGATGGAGTTATTCAG
GTTTACACGCGTCATTTGCCAACGTGGATCCGGCAGATTTCTAACATGGC
TTAAGGTGTATTGGGAGAACAATGGCCAGTATTGCCCATTCCCGAATGAT
TTTACACATTTGATGATAGCAGCGTGGCTAGGGCAGCAAAGAGTAATCAA
GCGGCTGTTGAAGGAAGGTGGAGACATTAACGCTCGATCGGTGGAATATG
GTACAGCGTTAAATATAGCAGCTCTCAGGAGACACAGGGATATAGCCAAG
ACCCTCGTGGAGGGGGGAGTCAATGCCTATATAGGCGGAAGGGAGTACAA
CATTTTACTTACGTGGAAGAGCGAGCTTGTGCGGATGATTGAACGAAACA
AAATTTTGGGGAGGGGGAATTGCTGACCTCTGGCTCTATGAGCGTATAGG
TGCGGATGCACGATTATCGGGTAAGTGAAGAGGACCAAGCACAGTTCTGA
GACAGCAAAGTTGCTGACCCTTGGGTCGCTGCGCGATTTAGGCGGGGGTA
TGTGAATAGGAAGCAGCACGATTTTGTGAACAGGCAATTGCTAACCTCTG
GATCGCCGAGCTTTCTAGGGGCGGGTAAGTGAATAGGGTCAAACACGGTT
GAAGGATCATAAAGTTTCTGACCTCTAAATCGCTGAGTTATATAGTCGGT
AAGTGAATAAGTACAAGCGCGGTTTTGCGAACAGGCAACAGCTAACCTCC
AGGTCCCTGAGCGTTGCAGCGGGTAAGTGAACAAGATGCAGTAGGGTTGT
GGGACGGGAGGATTACTGACCTTTGGATTGCTGAATGTTGTAGGATGATC
GGGTAAATGTACAGCACGAAAATGTTCTAGGACAAGGTCGTTGCTAACCC
TTGGGCTACGGGATATTATAGCGGGAGTATGAGATTATTATGTTTCTTGT
AGTGAGTACTATGGTTTCATTATTATCAGCCCTGTCAG

Sequences in the Contig:

SY0AAA17YN18FM1 SY0AAA18YK06FM1 SY0AAA1YD15FM1
SY0AAA24YB05FM1 SY0AAA24YB05FM2 SY0AAA25YA08FM1
SY0AAA26YL08FM1 SY0AAA26YP09FM1 SY0AAA27YJ10FM1
SY0AAA31YE11FM1 SY0AAA32YL24FM1 SY0AAA37YF22FM1
SY0AAA45YI17FM1 SY0AAA49YF03FM1 SY0AAA53YL07FM1
SY0AAA54YH14FM1 SY0AAA54YK16FM1 SY0AAA7YO11FM1
SY0AAB11YD01FM1 SY0AAB18YK24FM1 SY0AAB20YH10FM1
SY0AAB25YO07FM1 SY0AAB32YH13FM1 SY0AAB32YL05FM1
SY0AAB42YH18FM1 SY0AAB51YO16FM1 SY0AAB56YP09FM1
SY0AAC14YD22FM1 SY0AAC16YC11FM1 SY0AAC20YI12FM1
SY0AAC37YE10FM1 SY0AAC41YB11FM1 SY0AAC43YJ23FM1
SY0AAC50YB14FM1 SY0AAC50YN16FM1 SY0AAC52YE14FM1
SY0AAC54YN01FM1 SY0AAC54YO24FM1 SY0AAC60YE11FM1
SY0AAC9YB01FM1 SY0AAD22YB24FM1 SY0AAD3YM13FM1
SY0AAD47YO22FM1 SY0AAD48YD11FM1 SY0AAD50YG18FM1
SY0AAD50YH13FM1 SY0AAD51YE05FM1 SY0AAD52YI14FM1
SY0AAD52YK01FM1 SY0AAD57YC14FM1 SY0AAD9YI04FM1
SY0AAD9YP03FM1