Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1527
Length(NT) : 730
Best Gene Model Blast : Link to GSTUMT00002750001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: lipoic acid synthetase precursor
Accession: ref|XP_754950.1| Score: 643 E_value: 2e-65
KEGG Definition: lipoic acid synthetase precursor [EC:2.8.1.8]; K03644 lipoic acid synthetase
Accession: afm:AFUA_3G06560 Score: 643 E_value: 9e-66
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2672 Score: 641 E_value: 9e-68
PFAM Definition: No Hit Found
Swissprot: O13642|LIPA_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1527
TTGGCGAATACATCCCCGCAATTGCATTCGCGACTGAGCTTCAAAATGTC
GCTCAGGGGCCCACTCCTCCTCCGCACAGCGCTTCAATTCCGCTGCCTTC
CTACACCCGCCACTTCCTCTACAGTTGCAACGACTCGACACCTAGCAACC
ACCTCCCCGCAACCACCAAGCACAAGCACGAGCAGTAGCAGCAGTAAAAA
ACGCCAGCCGACAACCTTCACAGACAAGCTCAATGCGGGCCCCTCCTTCT
CGGACTTTGTCACGAACGGTGCGGCACTAATCACTGATGCGGAAGAAGCG
CTAGAACTCTCCTCGGCCACTGGCACCACGGGCAACAAACCCCAAGCCTT
CGACGGGCACGGAAACCCAATCACCCGTCTACCTACCTGGCTCAAGACGC
CAGTCCCCATAGGCGCCAACTTCGCCCGCATAAAGTCCGACCTGCGCGGC
CTGGGCCTGCACACCGTCTGTGAGGAGGCGCGATGTCCAAACATCTCCAC
GTGCTGGGGCGGAACGGACAAGTCCTCCGCCACGGCCACCATAATGCTGA
TGGGCGACACCTGCACGCGCGGTTGCCGCTTCTGCTCCGTCAAGACCTCC
CGCACGCCCGCGCCCCTGGACCCGCACGAGCCGGAGCACACGGCTGAAGC
GCTGCGACGGTGGGGTCTCGGATACGTGGTTCTGACGTCCGTCGATCGCG
ACGACCTGCCGGACGGCGGGGCCGCGCATT

Sequences in the Contig:

SY0AAA53YJ24FM1 SY0AAB41YN05FM1