Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1526
Length(NT) : 1705
Best Gene Model Blast : Link to GSTUMT00002310001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein An03g06460
Accession: ref|XP_001390521.1| Score: 497 E_value: 6e-48
KEGG Definition: hypothetical protein
Accession: ang:An03g06460 Score: 497 E_value: 3e-48
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism, Lipid transport and metabolism].
Kog Number: KOG0157 Score: 343 E_value: 9e-33
PFAM Definition: p450, Cytochrome P450. Cytochrome P450s are haem-thiolate proteins involved in the oxidative degradation of various compounds. They are particularly well known for their role in the degradation of environmental toxins and mutagens. They can be divided into 4 classes, according to the method by which electrons from NAD(P)H are delivered to the catalytic site. Sequence conservation is relatively low within the family - there are only 3 absolutely conserved residues - but their general topography and structural fold are highly conserved. The conserved core is composed of a coil termed the meander, a four-helix bundle, helices J and K, and two sets of beta-sheets. These constitute the haem-binding loop (with an absolutely conserved cysteine that serves as the 5th ligand for the haem iron), the proton-transfer groove and the absolutely conserved EXXR motif in helix K. While prokaryotic P450s are soluble proteins, most eukaryotic P450s are associated with microsomal membranes. their general enzymatic function is to catalyse regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures..
Pfam Number: pfam00067 Score: 392 E_value: 2e-38
Swissprot: P17549|CP53_ASPNG
Gene Ontology:
GO:0005792 = Cellular component: microsome
GO:0018664 = Molecular function: benzoate 4-monooxygenase activity
GO:0006118 = Biological process: electron transport

Sequence:
>Contig1526
TTGGCACACGACAAGCCATCAATTTGTTCCCCTTTTCTCATTGCCCCCCT
CCGACCAGAATGATCGACAGCGAATATTTCCTCAATGGAATATCCAATAT
GGAATATCTGACCGCCGCGATATGCGCCTTCGGGGCACTCATCGTTTGGA
AGCTTATTTCTGCCATTTTCTTCTCCCCGCTCTCACATATCCCCGGACCG
TTAGTGACGGCAGTGACTCCGCACTACATAAACTTCCTTTCGGCACTCAA
CCAAAGGACCGTCGGGACCTATTCATTACACAAGCGCTACGGACCAATAG
TTCGGCTATCACCCACCGAAATCTCGATTCTTTCCCCGCAAGCCATCAAA
GAGGTTTACTCTTCCCCCCATTATACCAAGTACACCCCCCTATACTCCAT
CTTCACACACTTTGGGGCCCAGAATTCATTCACTAGCTGCACCCGCGAAG
AGCACGGATGGCGGAGAAAAGCCGTGTCGGAACCCTATTCGCTATCCTTT
GTGCTCAAAGATGAAGCAGCAACGGGAAAGGTACTCAAGGCCGTCAAAGA
TTATTTGGGCTTCGTGGAAAGCGATAGGAGAGTTGACATTTATAATGCGA
ACACATTTTACGCGACGGATGTGGTCACCGGGAAGATATTTGGATTGGAG
GCCTCTATGAAGACTCTCGCTGGAAATGAAGAACATCGCGAGATCGTTCT
TGGACATTATGCCCGAACCCGAAGAACTCAGGTTTGGATGTACATTGAAT
TCCCCTTGATCATGAATCTATTTGAGTGGTTCGCGTTCTATACGGGGAGG
GTGTGGAGTTGGATACATGGAGAGGAGATAGAAGGCTGGGAGATGGTGAG
CCAGGCTCAAAGGTGGGGTTGGGATGCATATATGGATGCCAAGTCAAATT
CCCGTGAAGGTACCGTCGCTGGAAGACTTGCGAAGCTTGTGCAAGAAGGC
GGTAGCGGTGAAGAGGCCTGGGACGATAGAGGTGCTGTTAGTGAAGTAAT
GGACCAAATGCTAGCGGGGATGGATACGACTGGTGACACTTTATCGTTCC
TTATGTACCAGATATCACTCCCAGAATCGAGGAGCGTTCAAAAAAGGTTG
CACTCCGAATTGCTCAACGCTTTCCCCAAGTCAGCGGAGATGCCAGGTCT
TGGCTGGCCCCATTCAATGGATGTCCAAAGCCTCCCTCACGAAACTATCC
TAAAAGTCCTGAATCTGCCATACCTCGACGCTGCTCTCAAAGAAACATTA
AGAGTGTATTCAGCCATTCCGATCACACTACCACGAGTTGTCCCCGCCTC
CACAACCACTGACAGGATTAGCGGTCATAGAAATGGAAGGATTCTTGAAG
GGAAATTTATTCCGGCCGGGACCACCATAGGGACATTGGCCTACGGGATT
CATCGTGACGAAGTTTTCGCTGTGGAGACCAAGCAGAAAGATGAGCCCGG
AGACGTCGATAGCTTTGTTCCAGAAAGGTGGTTGATCAACGGCGGTATCG
AAGGCAAATTAACCCCCGACGAGTTGGAACAAGAGAAGCAAAGAATCCGA
ACAATGGAGGCAAGGCTTTGGGCTTTTGGCAGCGGCGGAAGAAATTGTGT
GGGAAGACACCTTTCTATTCTCGAAATGAAATTGTTGCTCGCAACAATAT
ATTCGCGCTACCAAACACAGGTTACGCCCAACAGTGGGGTAAAGATCACA
CACAA

Sequences in the Contig:

SY0AAA53YJ19FM1 SY0AAB42YB16FM1 SY0AAB43YN11FM1
SY0AAB46YN09FM1 SY0AAB53YM18FM1 SY0AAD39YK19FM1
SY0AAD47YL10FM1 SY0AAD9YI12FM1