Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1525
Length(NT) : 1750
Best Gene Model Blast : Link to GSTUMT00006679001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: PREDICTED: similar to Protein Mo25 (dMo25)
Accession: ref|XP_393376.2| Score: 886 E_value: 5e-93
KEGG Definition: AgaP_ENSANGG00000021597; ENSANGP00000023148
Accession: aga:AgaP_21597 Score: 885 E_value: 3e-93
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1566 Score: 985 E_value: 1e-107
PFAM Definition: Mo25, Mo25-like. Mo25-like proteins are involved in both polarised growth and cytokinesis. In fission yeast Mo25 is localised alternately to the spindle pole body and to the site cell division in a cell cycle dependent manner..
Pfam Number: pfam08569 Score: 1137 E_value: 1e-125
Swissprot: Q9Y376|CAB39_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1525
TTGGCACTCTAAAAACAACTACCCTCTAGAACGCCAGCCCCCGCTCAACT
TTGCCTAATACATCCTGTCATCTTCCCTTCCCATACCAGTGCCAATCACT
GAGTGCTCAACGCCATCAACCTTTTCATCACGGAAACGCAGCTCCCTTCC
CTCTAATCCTCTCCAGCCAGCTATCAACTCTCCTCCTCTCCACCTTTTCC
ATTCACCTCTTATTTGCTATAGCACCGGCTCTACACTTCCAGAAGGGCCT
CCACCATGTCTTTTCTCTTCGGCAGAAACCGTCAAAAGACTCCCCAGGAC
CTTGTGCGGGCCGTTCGGGAGTCTATCTCACGAATGGATGTCCACTTAGA
GAGACGCCGTGCATCCGAAGACGTCTCGCGGCTACTTGCTCAGATGAAGG
TTGTCCTACAAGGGAATGCAGAAACGGATCCAATTCCAGATCAGGTTCAG
ATGTTAGCCCTGGAAGTCTACGCAATAGATTTACTCCCATTGCTTGCGAA
TAACATGGCTCGATTGGACTTTGAGGCCAAGAAGGATGTGACTGCACTAT
TCAATGGCCTCCTTCGATACTGCCCACAGCCTATTAGTCGCTTTCCCACC
GTTGACTACCTCCATACCAACCGTCCGGACACCTTAATCACCTTGGTCAA
GGGGTACGAAAACAAAGATGTGGCCAACAATTGTGGGACAATTCTTCGAG
AAAGCTTTAAGCATCAGGCTTTGGCACACGTTGTACTTTATGACGAGATA
TTCTGGAGGTTCTTTGATTATGTTCAGGGTGGCAGCTTTGACATCGCGAG
CGACGCTTTTGCCACTTTCAGAGAGCTATTGACCAAGCATAAGCCACTAG
TAGCTCAGTTTCTCGGCCAGAACTACGTTAGATTCTTTTTGAAATACAAT
ACACTTTTAGTGTCGCCGAACTATGTTACCAAACGGCAGTCGATTAAGCT
TCTTGGGGAGATTCTTCTAGATAGGGCGAACTACAACATAATGCTTGCTT
ACGTGGATTCTCCGGATCACTTGAAGTTGACGATGAATTTATTACGTGAT
AAGAGTAAGAACATTCAGTATGAAGCGTTCCACGTTTTCAAGGTCTTTGT
GGCGAACCCAAAGAAGTCCAAGCCTGTGCAAGAAATTCTGTTGAAGAATC
GAGAGAAACTTCTAGCTTTCCTGCCCAAATTTCACGACGATCGCCGAGAG
GACGAACAATTCATCGATGAAAAGGGTTTCCTGATGAAGCAGATAATTGA
GTTGGGAAATCAACCGCAACAGCCCCAAGGCGCAGTTTTCGCATGATACA
GTAGCTTGATGAATTTTCGGCCATGATTGTGACTATCGTTTGGGGTTGAT
TGCTATTTTTTCTTTCTTCCTTCCCCTTTCTTTTTTCTCTATTTGAACGG
CTGTCACTATGTGGGATACGGGGCGAAATATTATACGACAGTGACGAGAG
TGATGATGGCCATGACCAACGTAATGGCGTGTAAGGTCAGGAAACGGCGT
TCGTTGTTTTTCCTTTTTTTCCTTTTTATGTCCGACATGATGGATTCCCC
GTGGCTTGTACCACTCTGATGTTCTTTTAGAAATGATCTTACCAGTCACG
ATAACTCGGCTTGGGGTTGCAATGGTATTTTATACCAGAGGCGGAACTTA
GCGCAATTACAACATGTCAGTCACTATGCTGCTTCTGGATATCGACACTT
TTGGTTTTTCTTTCTCCTTCTGTTCCCTTTTTTTCTTTCTTCTGTTTTCG

Sequences in the Contig:

SY0AAA53YJ13FM1 SY0AAB26YJ15FM1 SY0AAB32YJ19FM1
SY0AAB34YC13FM1 SY0AAB47YE07FM1 SY0AAC36YJ15FM1
SY0AAC39YO11FM1 SY0AAD39YJ05FM1