Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1524
Length(NT) : 1264
Best Gene Model Blast : Link to GSTUMT00000288001 E-value : 1e-156
Numbers of ESTs : 5

Blast Results:

Nr Definition: heat shock 70 kDa protein
Accession: ref|XP_001248723.1| Score: 858 E_value: 5e-90
KEGG Definition: molecular chaperone Hsp70; K03283 heat shock 70kDa protein 1/8
Accession: afm:AFUA_1G07440 Score: 844 E_value: 1e-88
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 804 E_value: 2e-86
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 781 E_value: 1e-83
Swissprot: Q00043|HSP70_AJECA

Sequence:
>Contig1524
TCATACAGACCTGCTGAGGAACCTCGCAGAGTTGGATCTTCACGTCGACA
GGAATGAGCTTTTCGGAAAGAGGATTGATCTTGACGAGACCAGGGTCGAC
TGCGCGATGAAATTTCCCAAACTTGGTAACGAGACCGACACTACCTTGGT
GGACCGGCTTGTAAGGATTCGGGCAAACAATGCAACACGGGACGGCACCA
AGAAATCCGATAACAGATCCCAAACCGCTAACTGATAAAGCACGTCAGTG
ATAGGCCAAACCATGGTTAGAATATCCGTGATGCGTACTCATAGACCCAT
ACCATCCTGTGGTAGACGCATCGTTCGGATCCTCCTCAAGGACCTGGGCA
TAGGAAGGTTGCAAATCGCTACGCTTGGCGGGTTGAACCGTAATCAAAGG
AGATTCAGTGTTTGTCGACCTTGCACCACCACCACCGGACGCTGAAGTAG
AAGCGAGATAGCCCCCAGCACTCTCGCCGACAGGGTTCTTAGTAGTACTC
ATCACTTCCGAACTTTTTCCTCTCGTGGTGGTATGGGCCAACTTTTTTGT
ACAAAGTTGTCCCCCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTT
TTGTACAAAGTTGTCCCCTGGAAGGCTCCGAGTCCTTTGTTCATCAAAAC
TTTTTTCACGAATCTCTTTATCCTCTGCATTACCTACCTAATCTCTCCTT
CATCAACCGAGTTATCCATATAACCTTCTCCCAAGATGGCACCCGCTGTT
GGTATCGATCTTGGAACCACCTACTCTTGCGTCGGTGTCTTCAGAGATGA
CAGAATTGAAATTATTGCCAATGACCAGGGCAACCGGACAACCCCATCCT
TTGTCGCTTTTACTGATACCGAACGTTTGATTGGCGACTCGGCAAAGAAT
CAAGTCGCCATGAACCCCCACAACACTGTCTTCGACGCTAAACGTTTGAT
CGGACGCAAGTTCAACGAGCCAGAGGTGCAGGCAGACATGAAGCATTTCC
CCTTCAAGATCATTGATAAGGGCGGAAAGCCATTTATCCAAGTTGAGTTC
AAGGGCGAGACCAAGGTGTTTACACCGGAGGAAATCTCATCCATGGTCCT
TACCAAGATGAGGGAGACTGCCGAGTCGTACCTTGGTGGCACCGTCAACA
ATGCAGTTATTACCGTTCCAGCATATTTCAACGACTCACAACGCCAGGCC
ACCAAGGACTCTGGTCTGATTGCTGGTCTTAACGTCCTCCGCATCATCAA
CGAGCCTACTGCAG

Sequences in the Contig:

SY0AAA12YC07FM1 SY0AAA53YI18FM1 SY0AAB56YE19FM1
SY0AAB6YI11FM1 SY0AAD3YK08FM1