Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1523
Length(NT) : 1045
Best Gene Model Blast : Link to GSTUMT00002919001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE58174.1| Score: 346 E_value: 1e-30
KEGG Definition: predicted protein
Accession: aor:AO090003001076 Score: 346 E_value: 5e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1523
TTGGGTCCTTACGGCCCTAATCGCACTAATAATCTACGTTTCTCGAATTT
ATAGTGTCAGGCGTTTGATGGCCGATATTCCGAAGTTCTACGCTCCTGTC
AGGAAAGTTTACTTAAGAGCTCGGGTGCATAAGGCCATTACGGCAAATTT
AAGCCGGAGCGCGGTTATTGCTGTGCAAAGTCGGCCAAGGGAAGGTGGGC
AGGGGGTTTGGGGGGAAATCAAGCATCCGGGTTGGTCCGACGGAACCGGG
AGGTTACCGAATGTACAGTACTTGTCAGTTGTCAAGGAGCTACCGAATTT
ATTGGAGATAGAAGCGTTATCGTTACGCCCTCCTGAGTCTTCAAGGGATG
GGCTTAGGACTCCTACGTCAAATGTATTCGAGGAGATTACTATGCCGGAT
CAGGAGGTGGTTAGACGACAGCCACATATGTCGTTCAGAGCCTATTTAAA
CCGGTTGGCAGCGGTCGGCTATGTACGACAGGATGTTGCAGATTTATTTA
TGGCTAGATATGAACGCGCTAGGTTCCGGAGTCAAGGTGAAGGGATTGAA
GAGAGGGAATTCATGGAGCTCATGCACATTTTTGCCGGATTATTGAAGAC
TTTGGGGGATGACTTGTTCACCGACTCGCCATCCACATCCTCGCGTCACC
GAAACTGGGAGCCCAGGGACGAGGATTCGAATGAGGAGGACCATCGGGAA
TGTATGGGGCTCGAAAGACGGGATAGATACAATAGCTCTGGATATGAAAC
GACAAGCACGGAACGCGAGGAAGGAGAAGGGTTACGGTCCACCCCCGATC
GCCTGAACGACGGCTTCGTCGTCGGTGTGCAAAGAAGGCGACCCGAAACA
ATTGGGTCGACAAATATCAGTATGCGCAGGACTACGACCGCCACTACTGT
AGGAAGCATAACCAGCCCTGAAGACAATGAGATAGAAATGGTGTCGCTGA
GGCCAAGGGGTACCAGAAGGTTGAGCGCAAGAACGTCGGCGGGGACTTTT
GGTTGACAAGTATATGATAATGCTGTTGTAATTTTCTTTTCCTTT

Sequences in the Contig:

SY0AAA44YH15FM1 SY0AAA53YI09FM1