Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1522
Length(NT) : 1087
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1522
TTGGCTACTGTGTGTGCCATCATACTCATACGTGATGTCGAAGAGCTTTT
AAAGAGGGCTGCCACAGGTTATCGCACACCACCAAAATTTGACGCTCTTG
TCTGGATCCGAGCGGTATGCAATAGTACGAGTACTCGTACAGTACTTGTA
GTTCTCTTTAAGAACGCCTCGGCACTACAAGTTCCGCTACCATTTTCTGG
CAGAATCTCGATCACCTCGGGTGGTGTAAAATTATGAGGCTGAAAACCGG
TTATCCTGGGTCCCCCCTTTTTTGGGCTGTGGCTAGAAGCTGATTATGCC
GGTTCTTCCAGTGGCTGTGCTTGTGGTGCCCCGGGGGAGCCGTCCTCGGA
CGAGACAGGATGAGGCAGTGAACCAGCCAGCAAAATAATTTACCGGTAAT
CCCGGCCCTTTACGAAGGCATCTCCCCTGGCACATTGTACGGGAATCGTA
GAGTGCACATCTCCAAAGAGTTGTTCGTGGCGCCGCCTACCCTCCCTTTC
CTTGGTTTCACGGATCTGAGTTTCGATATGCGCCATTTTATCTTCAGCAA
TTTTTCTGGCCACGTGAATACAAATTATACAATACATAAGTCCTTTGGCT
CCTTCTAATGACTAGCTTGGATAGACATCTATAATCTATGGCAGCAGACA
GGCGGACAGCTAATTTGGCTCAATCGTTTCACGGAAAACTCTCATCACCA
GTTCCTACCTTGGCTTGCCGAAAGCTCTGAAGAGGGGAGGAAAAGCATAT
AAGGCAAAACTCTGTAGCCCTCTCCAATAGCGGCCTTTCCATATCTCCCT
GGCACTGAGCTTGGTAGTGGAGTGGCTTGATGAGAGGAATCGGAGCGATC
GAGCACGGGCACCATAGGAGTCTATTTTGGGAGGATATGCTAAAACAGAG
GGCAAAATCGCAGAGCTGTTAGGCGTGCTGTTTCCGGAAAGGAGTGCTTT
CTGTGCAGGGGCGGCATTATGTTGGTCGCATGGGGAATTTCCAGAGAGGC
TAGAAGGTTTTGTGGAGTAGACTACTGATACCGTGAGGTAGAGAGAGTTC
TCGTAGGGCCTAAGTACTGATAATTTACAACCTGGCT

Sequences in the Contig:

SY0AAA27YM12FM1 SY0AAA31YP09FM1 SY0AAA33YL02FM1
SY0AAA53YI08FM1 SY0AAA54YM21FM1