Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1521
Length(NT) : 827
Best Gene Model Blast : Link to GSTUMT00001032001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: G-protein comlpex beta subunit CpcB
Accession: ref|XP_001266728.1| Score: 1152 E_value: 1e-124
KEGG Definition: G-protein comlpex beta subunit CpcB
Accession: afm:AFUA_4G13170 Score: 1147 E_value: 1e-124
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0279 Score: 973 E_value: 1e-106
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 126 E_value: 5e-08
Swissprot: Q01369|GBLP_NEUCR

Sequence:
>Contig1521
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGAAAGCACAAACAGTTCAA
CGACGTTAACGATCCTTTCCTTCAGCATTGAGACTCAGATCACGTCGAGA
ACGCTTGCTTAATTACACAAAATGACTGAGCAGATGGTTTTGCGCGGAAC
CCTTGAAGGGCATAGTGATTGGGTTACGGCCCTTGCTACCTCCCTCGAGA
ACCCCAACATGCTCTTGTCTGCTTCGCGCGACAAGACCTTGATCATCTGG
AATCTCACTCGCGATAGTGATACTGGCTACGGTGTTCCCAAGAGAAGTCT
TAAGGGTCATTCTCACATCGTTTCTGACTGTGTCATCTCTTCCGACGGCG
CATATGCCCTCTCTGCTTCATGGGACAGGACCCTCCGTCTGTGGGAACTC
TCCACTGGTCAGACCACCCGCCGCTTCGTCGGCCATGATAACGATGTCTT
GAGTGTTTCCTTCTCTGCCGATAACCGCCAGATCGTGTCTGGGTCTAGGG
ACCGTACTATTAAACTCTGGAATACCCTTGGTGACTGCAAGTTTACCATC
ACTGATAAGGGGCACACTGACTGGGTTTCTTGCGTCCGTTTCTCGCCAAA
CCCTCAGAACCCGGTGATTGTCTCTGCTGGATGGGATAAGTTGGTTAAGG
TCTGGGAGCTGGCGTCTTGCCGCATTCAAACCGATCATACCGGACACACT
GGATATATCAACACTGTCACTATCTCCCCTGACGGCTCCCTCTGTGCCTC
TGGCGGCAAGGACGGCACCACCATGCTCTGGGACCTTAACGAGTCTAAGC
ACCTTTACAGCCTTAATGCCGGTAATG

Sequences in the Contig:

SY0AAA2YF19FM1 SY0AAA43YB17FM1 SY0AAA53YH15FM1
SY0AAB14YJ01FM1 SY0AAB16YC04FM1 SY0AAB19YP12FM1
SY0AAB26YF09FM1 SY0AAD13YG09FM1 SY0AAD40YG17FM1