Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1520
Length(NT) : 706
Best Gene Model Blast : Link to GSTUMT00008233001 E-value : 1e-171
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_09359
Accession: ref|XP_001589637.1| Score: 301 E_value: 8e-26
KEGG Definition: hypothetical protein
Accession: ani:AN4832.2 Score: 272 E_value: 9e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: A7KAN7|ATG29_PENCH
Gene Ontology:
GO:0000407 = Cellular component: pre-autophagosomal structure

Sequence:
>Contig1520
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTTTTATCCTAAAACATAT
AATGTCAGAGCCTACCCTTCTACCGACCGCCAGGTGAATCCTTGAGTAAA
ACACTCGGCTGCCCCGTGTCTCCAGCTCCTCGCTCTTGTCTCTTCCATCA
CCTGCTCACCCCGTTGATCTTACTCGCTTTGATGCCAGTACCCGTACCAA
CCTTATTCAACCAGCTTATCGCCAAAATGCCTAATGTTTTGGGACTCGGA
TCCCGCCAGTCATCCGCTCGTGGAGCTACAGGAGCTGGAGGGGGAGGGGG
AGGACCCGGGGAAGTGCCTGGGGCCGGTTCCGGTCCTTCACGCACGGGTA
CACCACTATCGCAGCGGACCAATTCACTCAGAGGAGAACGGGAAGGAAGT
CGTAGGGGTCAAACACCACCAATGCCCCAACAGCCTGAAGAAAAGTATAT
TGTCTATTTGAGATTCCCGTTTGCAAGGAATGGGTTTGTCGATCCGCCGC
AGGTGGATTGGGACGCTGGGAAGGAAAGGTACCTCTGGAAAGTTCTTTCC
CGGAGCAATCGAAATGCAGACTTAGATTGGAATGCGCTTGCTAGCCATCT
TCAGGTTTCTCGCGCATTTCTACTCCAACAAGCTGCATGGCTTTACGAGC
GTGAGCTTTCTCAAATTCAAGCTCAGATGCGAAGGGCCGGAGGGCCCATC
CTGAAC

Sequences in the Contig:

SY0AAA53YH10FM1 SY0AAD41YN19FM1 SY0AAD60YF08FM1