Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig152
Length(NT) : 2354
Best Gene Model Blast : Link to GSTUMT00006664001 E-value : 0.0
Numbers of ESTs : 19

Blast Results:

Nr Definition: hypothetical protein FG09634.1
Accession: ref|XP_389810.1| Score: 616 E_value: 1e-61
KEGG Definition: hypothetical protein
Accession: fgr:FG09634.1 Score: 616 E_value: 7e-62
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig152
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGAGGGATCTCTCTCTTGACCTGGCACTTTCCGCCTTGCTCCC
TTTGTGTGTCTCATCACCCACGAACCTACTCGAGTACATATCTCCCCTGT
TCCATACAAACTTCGACCTCGAGAAATATCCACCGTTGTAGCATTAAATC
TTCCTCCATACCTTCGTCTTCCCGCAAGACCGTTCTCTCCAGCAGCAACA
CCCAGTTATACCATACACGGCGGCTCAGTTACAAACACCGATACCTGATC
CCTGATTTTCCCCACGCGTTGCATAAAATGCCGTTCTCCAAGTCGGCCCC
TTCTCACATATTTATCGTTCGCCATGGAGCCCGGTTAGACATGGCCGATG
CTCAATGGCAACTCACCTCGCCAACACCATACGATACACCCCTCACATAC
GGGGGATGGACCCAGTCCCGCTCGGTAGGAGTTCGAATAGCCACGTTGAT
TGGAAATCAGTTGGACCATCCGTCCTCTCCATTAATGGCCGGGGGCAAAG
GGGAAGCAAAACGAAAGAGGAAGAGGGCCAAGAAAGTGCGGGTTGTCATT
CACTCTTCTCCTTTCCTCCGGTGCATCCAGACGAGTGTGTCCATTGCCGC
GGGGATGGCCCAGCACCACCACCAAGAGGTTACAAATGCCCACTTTGTCG
CTGAGCACCCCATTGAGCCGACTACGGAAGCCCGATCCAAATTTCAGTTC
ACAAAGCCGCTTCTGCGATTGGATTCGTGGTTGGGGGAGTGGCTGGCCGA
GGATTACTATGTCGATATTACTCCGCCACCTCCAACCTGTTTACTTATTG
GAACTGCGAAAGCGGACTACATTCGGCCATCCTCCGCGAGTGGGATTCCT
GTAGCTCCTGTCACCAATGCCTCGCCTTTGTACAATCTTTCTTCCCTGAC
CACCTCCCTTCCGACCACTTTCACCGGCGGGTATGTGCCACCCTCGCCAA
CCTGGGCGATCTCCAATCACGGGAAAATTCCGACTGGCTACGTTTCGCAT
GCCAAGGAATATGTTGAGTTTGATCTCGGATGGGACTCTTCAAAATTGGG
AAGTGGAGCAGAGTATGCCGAGGAATGGGCTAGCATGCATACCCGTTTTA
AGAATGGGTGGAAGAAGCTGCTTTGGTACCACTCTAGCGAGGATCCGAAG
ATGACTACTTCCCCCACCCGGTGGAAACGTGCGACAGAGATCAGCTTCTC
GGAGACCAAGGAAAAGAAGACTTCTTCTAGCACTGCAACCGTCACCGCAG
TCGACCCCAACACCACTAGAGGGAGTACGGGGGGAAATCCGACACCCCCG
TTATCGGACGGCGAAGGGGGAGCGGAAGAGGAGGATATGGAAGAGGAAAT
CCAAACGGTCCTAATCCTTGTCACCCATGGCGCTGGCTGCAACGCCTTGA
TCGGCGCCATCACGCATCAACCAGTCTTAATAGACATTGGCATCTCTTCA
CTCACAATGGCCGTGCGCAGAGACTTGGACCCAGACCCACCACCATACCC
TACCAACAATACAAAAACCTTCCATCACCACAGCACCTCAGCCCCAACGT
CTGGAGAAATCCCCACGCCACCCGTACAATATGATTTGAAGATTACAGCA
AACAACGATCATCTCCGCACCTCTACCCCGCTGTCCACACCCCCGGTTAG
CCCGAACCTACGTTACGGCCTCAATTCCCTAGCTCCAATTGGGAACTTTA
CGCTTAGTGGCAGCGGTGTCGGTAGCATGTCTAGGGTGTTTGGCAATAAC
ACTGTCCGTCGTAGCGCGAGCTCTGTCGGACCGCTGGGTTCTGGGAATCA
CAGGGGATTGTGGAGCGGGCGCTCAGGGCGTGAGTCCCGTCCTGACAGTC
GGGAGGAATTCACACCCCTGAGCCTATCCGGTTCGTCCTTCACGAGCGCG
GTTGATGAGGGCAGCGATGATGGGAGTTCAGGTAGCGTGACGGGCCTTTG
GGACGCGAGCGGATGGGAGCGGAAGAGAAGGTGGACTGTTTCTCGCAGTG
GCGTCCCCGGTTAAATATTCAATCCTTCAGAGTGGGAACGCGGTGATAAT
GTAGTGTACAAAGAAGTGTTTTTAATCCCGCTGGTGGGTTTTCATCTTGT
TGTTTCTTGGGTATTGTTTTTTTTTGGGCTCTTATTCTTCTCACTCAACT
CCATGGTCGGCGTCCTTGTTTTTCAGATCTATTTTTCTTCTTCTTTGCAC
CGCCCTTTGCGTGATCCCCACTCCTAGTTCTTTGTCCGTCTTACCTACGT
GCGCACTTATTTAGTTAATTAATAGGCTGCTATCCTAAGTTATCTTGAGG
AGAT

Sequences in the Contig:

SY0AAA13YI12FM1 SY0AAA15YB16FM1 SY0AAA15YJ18FM1
SY0AAA34YO18FM1 SY0AAA47YH17FM1 SY0AAA57YM16FM1
SY0AAB23YI01FM1 SY0AAB33YF18FM1 SY0AAB41YB11FM1
SY0AAB45YL17FM1 SY0AAB58YH20FM1 SY0AAB58YL17FM1
SY0AAC32YF20RM1 SY0AAD14YO19FM1 SY0AAD33YC20FM1
SY0AAD33YN10FM1 SY0AAD56YP11FM1 SY0AAD61YE07FM1
SY0AAD63YM23FM1