Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1519
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00007772001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein Kpol_1070p6
Accession: ref|XP_001643983.1| Score: 889 E_value: 4e-94
KEGG Definition: ubiquitin and ubiquitin-like proteins
Accession: aor:AO090003001182 Score: 889 E_value: 2e-94
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0004 Score: 369 E_value: 3e-36
PFAM Definition: ubiquitin, Ubiquitin family. This family contains a number of ubiquitin-like proteins: SUMO (smt3 homologue), Nedd8, Elongin B, Rub1, and Parkin. A number of them are thought to carry a distinctive five-residue motif termed the proteasome-interacting motif (PIM), which may have a biologically significant role in protein delivery to proteasomes and recruitment of proteasomes to transcription sites..
Pfam Number: pfam00240 Score: 280 E_value: 6e-26
Swissprot: P61864|UBIQ_YEAST
Gene Ontology:
GO:0022625 = Cellular component: cytosolic large ribosomal subunit
GO:0005739 = Cellular component: mitochondrion
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0016567 = Biological process: protein ubiquitination
GO:0042254 = Biological process: ribosome biogenesis and assembly
GO:0006412 = Biological process: translation

Sequence:
>Contig1519
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCACCTTTCTCCCCCATCTA
CTACGAAACTCTTCTACTCAAAACTTCCATTTAGCAAAAACATCTTCCAT
AAAAACAATCAGCCATGCAGATCTTCGTCAAAACTCTCACTGGAAAAACC
ATTACCCTTGAGGTGGAATCGTCGGACACTATCGACAACGTCAAGTCTAA
GATTCAGGACAAGGAGGGAATTCCTCCAGATCAGCAACGTTTGATCTTTG
CTGGAAAGCAGCTTGAGGACGGACGCACCCTCTCAGATTACAACATCCAA
AAGGAGTCTACCCTTCATCTTGTTCTCCGTCTTCGTGGCGGTATGCAAAT
CTTTGTAAAGACTCTAACTGGCAAGACAATCACCCTCGAGGTGGAGTCTT
CTGATACTATTGACAATGTCAAGTCAAAGATCCAGGATAAGGAGGGCATC
CCCCCAGACCAGCAGCGCTTGATTTTCGCCGGCAAGCAACTTGAGGATGG
TCGTACCCTTTCCGATTATAACATTCAGAAAGAGTCCACCCTTCACTTGG
TTCTTCGTCTTCGTGGCGGAATGCAAATCTTTGTCAAGACCTTAACCGGC
AAGACAATCACCCTCGAGGTCGAGTCCTCGGACACCATTGACAACGTCAA
GTC

Sequences in the Contig:

SY0AAA53YG09FM1 SY0AAB44YN23FM1 SY0AAC57YG07FM1
SY0AAD42YM04FM1