Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1517
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00000795001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3091 Score: 179 E_value: 2e-14
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 112 E_value: 1e-06

Sequence:
>Contig1517
TTGGCGCCACTCCTGCCCCCGCAAGCGGCGGTCTGTTTGGAACTCCCTCA
ACAACTACCCCTACCACCGGAGTCGCGCCCACAGGGGGACTATTTGGTGG
TGCTACTCAAGCAGCTACCTCAGCCCAGCCCGCCGGAGGACTCTTTGGAG
CTGGAACAGCGGCATCAGCTTCTGCGCCCGCTACTGGAGGGGGATTGTTT
GGTGGGGGAACTTCGCAGCCGCCTCCTAAGCCTTTATTTACTGGCCCTTC
TGCAGCAACCACTTCTGGCACCGGTGCATTTGGTAGCACGGCAACTCCAA
GGCCTGGTGGATTATTCGGTGGGACTACTCCTAGTACCACACAACCGCAG
CAGCAATCACAACAGCAGCAGAACACAGTTCCAGCAGCCACCATTGATGC
TTCAAAACTTATACCAACTACCAGATTCGGAGACTGCCATGCAGAGGTTC
AGAGAATTCTAGAGGGCATTGAACAAGAGATCCAAGAGCAAATCCGCATC
GCCACAGAGCTAACAGCCCACTTCCCTGGCCACCGCGCAACCATCGACTC
TATTCCCTCAGACACCGCAGTTCTAACCCACAAGCTCGCAACCACCAAGT
CCTTCCTCGCCGCTGACGACGC

Sequences in the Contig:

SY0AAA53YF22FM1 SY0AAC8YB07FM1