Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1516
Length(NT) : 707
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1516
TTGGCACCTCGCGGTTGACTTGGTCGTTGCTCACCCCTCTGTGGACCTGC
TTCCTTAGTCCCTCCAACGCTCATCTGACCTTCTGGGTGGTGACGATATC
GTCTTGGCTGTATTTCGTCTTGAACTTTTTTCTTTGCTTTTCTTTTCTTT
TTTCCCTCTCGTTTTTCACTTCTGTTTATTTCCTCGTTTGCATTCTTGGG
CATTGATCTTGCGAGATTTTTTTCCCTTCTGAGTTCGCCAGCCTCAGTGG
ATTTTTCCTGGTAGCCCTTATCGATTCGGCCTCGCCTAAGTTTGCAGCTC
CTCACCAGCCCCAAGTTCTCAGTGCTGGGAGGACCCTTCTAACCCAGTCT
CCAACCTCCCTCTCCGCTCCGTTCGTCGAACCAACACCGCACAAAATACC
ACCTTCCCGCACTAGCCTCACCAATCCTTTGCGACTCGTGACTTCGCGAC
TCGGTCCTTACGGAGACAGGTGGACGGGTCTGACAGGGTGATTCAATCTG
AAGGGAAATAAATTGTATTTGTGTGTGGTCGTTGAAACCCTCATTAGAAG
GATCCGTTGAATTGTTAGGGGTGGTATTCCTGTTGGTTGGTTTGACGTCG
GACCAAACGGAAACCCCAGAACCAAAAAAGCACCCTCATTATATTTTCTC
CAGTAATACCAACCCCAGAGGAGGTGCAGGAAGGCTGGTTACTGCAGACA
CCTGTGT

Sequences in the Contig:

SY0AAA53YF19FM1 SY0AAB48YH09FM1