Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1515
Length(NT) : 1816
Best Gene Model Blast : Link to GSTUMT00000918001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: Vacuolar protein sorting-associated protein 27 emb|CAD79688.1| related to vacuolar protein sorting-associated protein
Accession: sp|Q7RZJ2|VPS27_NEUCR Score: 1464 E_value: 1e-160
KEGG Definition: hypothetical protein
Accession: fgr:FG08545.1 Score: 1432 E_value: 1e-156
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1818 Score: 738 E_value: 2e-78
PFAM Definition: VHS, VHS domain. Domain present in VPS-27, Hrs and STAM..
Pfam Number: pfam00790 Score: 390 E_value: 4e-38
Swissprot: Q7RZJ2|VPS27_NEUCR
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane

Sequence:
>Contig1515
TTGGGTTCCATCTGCTGTAGCTATTAATCCTCCTTGTCTGTCTCCTTCCA
CCTACTCCTCTCCCATCATAAGCTACCCTTTGCTACTTTACCTACTATAG
TTGATATTGCTTGTGGCTTTTTGAATCTAATCCTCCCCCATTCCTGAATC
CGCTCTTTTTATCACCTTCGTTAGGCACTCTTTGTGCTCAGCCTCTTTCG
AACGATCACCATCACTTCTATCTTTACATCGCCCCGTAAAGATACGGTAC
CTATGGCGTGGTTTACAGCATCGAACTCGTCTCTTGACGACCAAGTCGAG
AAAGCTACATCTTCGAGCTTAGAGGATATGGCACTCAACCTAGAAATCTC
CGACATCATACGGAGTAAGACGGTTCAACCAAAAGAAGCTATGCGCTCTT
TGCGGAAGCGAATAGGACATCGTAATCCTAATGTTCAGCTAGCGGCTCTA
AGTCTTACAGATACCTGCGTCAAAAATGGAGGATCCCACTTTTTAGCCGA
AATTGCCTCACGGGAATTTATGGACAATCTGGTTTCTCTACTAAAAGTTC
CTTATTCACTAGACCCCAAAGTTGAGAGCAAGATACTAGAGCTCATACAA
ACCTGGGCATCTGCGTTTGAAGGGAAGAGCCATCTTTCATATGTCGGGGA
GATATATCGAATGCTCATAAATGAGGGTTTTAACTTCCCACCACCAACAA
AGGTTTCCTCATCATTTGTTGACTCTTCGGCGCCTCCTGACTGGACTAAT
TCAGATGTTTGTATGCGGTGTCGAACACCTTTTACTTTCACTAACAGAAA
GCATCATTGCCGCAATTGCGGAAATGTTTTCTGCGGTTCTTGCTCCTCGA
AGTCGATACCACTCCCTCACATAGGAATAATACAGGCCGTTCGTGTGTGC
GATGGATGTAACACTAAATTGACCGAGAAGCGGGTCTTGGGCCCTTCAGC
GAAACCGCAGTCTCGTCCGCCTCAAGTGCAGAAGCAAAAACCAAATAATC
TTATGCAGCCGAGAAACGCTAGGGTTGAGGACGACGACGATGAGGACCTC
AAAATGGCGTTGAAGATGTCGTTGGAAGAAGTTAAGGGAAGGGGAAGTGC
GGGTTATGTTTCCCAACAGCAGTTACAAGCTCAGAGACAAACCGCTCCAC
CTCATGTCTCGACATCCACCGTCCAAACTTCTGCTTCTAAGCCATTAGGG
GGGAAGGCTATGCCTGACGAGGACGAGGATGAGGAGTTGAAGGCGGCGAT
CGCTGCGAGTTTGAAGGATATGGAGGAGCAGAAAGCAAAGTCTGCGTGGT
CGAGCCCGAGTGCCGCAGTCAAGTACACTGCTTCGGCTTCACAAGCAAGT
GTCACCCATAGACCTGATCACGAACTGAGCCCTGCTGAGGCCGAAAACAT
CAATCTTTTTGCCACGCTTGTTGATCGACTGCAATCCCAACCGACTGGGA
CAATCCTCAGAGAACCCCAGATTCAAGAGCTTTATGACAGCATTGGTGCT
CTAAGGCCAAAATTGGCCCGAACCTTTGGTGAGACCATGAGTAAATATGA
GGCTCTATGTGATCTACACGCAAAACTTGGTACTGTTGTACGCTATTATG
ACCGGATGTTGGAGGAGAGGTTGAGCTATACCTATGGTCGGCATGGGATC
GGGGGAGTTTCTTCCCCCGCTCCTTACCAACAACTCCCCCCTTCGAATAG
TGCGTATCCTACTTTGCCTTCTGTTGAGGGCTATTATGGAGTTGGTGGGG
GTAACACACCAGGAGCTCCACAAAATCCCTACCCCAATTCGCAGACGAAT
TATCAGAATTATTATA

Sequences in the Contig:

SY0AAA20YB01FM1 SY0AAA30YD10FM1 SY0AAA34YP21FM1
SY0AAA35YO23FM1 SY0AAA50YN11FM1 SY0AAA53YF08FM1
SY0AAA60YE11FM1 SY0AAB20YO24FM1 SY0AAB43YH09FM1
SY0AAB43YN23FM1 SY0AAC26YF09FM1 SY0AAC42YP02FM1
SY0AAC52YD17FM1 SY0AAD22YA16FM1 SY0AAD48YB12FM1