Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1514
Length(NT) : 889
Best Gene Model Blast : Link to GSTUMT00010287001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: N-acetylglucosaminyl transferase component Gpi1
Accession: ref|XP_001263473.1| Score: 967 E_value: 1e-103
KEGG Definition: hypothetical protein
Accession: ang:An16g03530 Score: 966 E_value: 1e-103
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1183 Score: 631 E_value: 2e-66
PFAM Definition: Gpi1, N-acetylglucosaminyl transferase component (Gpi1). Glycosylphosphatidylinositol (GPI) represents an important anchoring molecule for cell surface proteins.The first step in its synthesis is the transfer of N-acetylglucosamine (GlcNAc) from UDP-N-acetylglucosamine to phosphatidylinositol (PI). This chemically simple step is genetically complex because three or four genes are required in both yeast (GPI1, GPI2 and GPI3) and mammals (GPI1, PIG A, PIG H and PIG C), respectively..
Pfam Number: pfam05024 Score: 584 E_value: 5e-61
Swissprot: O14357|GPI1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0000910 = Biological process: cytokinesis
GO:0006506 = Biological process: GPI anchor biosynthetic process

Sequence:
>Contig1514
TTGGGGAGGATTGTGTTGAAGGGGTTAATGGATACAGCAAAGTTTCTGTG
GCCATTTGCTACCAAGCTGTTCGTACTGAAAATATTGATTTGGAGATTGG
TCGCAGAAACGATTCTAAGAGTGTTGGAATGGAGGCTGCGGCCCGAATTG
GCAGCATTGAAGGACATTTCTGCTACAGCCCAGCAGTTCGATATCCGCCT
TCAGCAGTTTTGTTATTGGCCAATACAGTATGTAACTCTGCGCCGACGAA
AAGCTGACTGGGAAAGTGTCACCACATCTCATCCGGATTATATTCGGTTT
TACAATAGCCTGTGGCTTGTGGCTAATGATGTTATCATTGGGATTGCTTT
GGGTTCTTACATAATTGAGAACGCAAGTGGGGTGGCATACCAGATTGATT
ATTACTTGAGAGCCTACACGGTCGAGGGCATGAAAGCAATGATAAGCTGG
CTGATGGAACACCCCGGTGGTTTGAAGCTCAATGACGACTTGGGGAATTT
TCTTGGTGATCTGTTCCTATGGGTCATAGATTACTGGGCAGATACTATGA
CAAACATCAGACCACACCTCCCTGGCGTAATCTATGCTATTGGGTTCTCT
AGTTTTGCGGGTGCCTCAATGCCTATAGCCCTGTTCTCGGATCTTCTTTC
CATCCTAACCTTACACGTATATTCCTTCTATATCGCATCCGCGCGCATCT
ATAACTGGCAGTTAACTATCATAATATCTCTCTTCCATCTGTTCCGCGGA
AAAAAACGAAATGTTCTCAGGAATCGAATCGACTCATGCGACTACGACCT
TGACCAGTTGCTCATTGGCACTATACTGTTTACCTTGTTAATCTTCCTCC
TTCCCACGGTCTTGGTGTTTTACCTTACCTTCGCATCTG

Sequences in the Contig:

SY0AAA53YF02FM1 SY0AAD9YN06FM1