Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1513
Length(NT) : 729
Best Gene Model Blast : Link to GSTUMT00007224001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 445 E_value: 2e-42
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 441 E_value: 2e-42
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 290 E_value: 4e-27
PFAM Definition: No Hit Found
Swissprot: Q02357|ANK1_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0048821 = Biological process: erythrocyte development
GO:0015672 = Biological process: monovalent inorganic cation transport

Sequence:
>Contig1513
TTGGCCATCTTCTATCCTCTACGATATCCTAAGCGGCAAATAAAAAGAAA
ATGGCTCCATCTTTCACGGGTAATATCAGCGTTTTCAATAGGTCCCGCGG
AACCCCACTCTGGTACGCTGCTATGAATGGGCACGAGGAAGTGGTGAAAA
TGCTACTCGAACGGCAAGATGTCATCCCCGATAAAGCGGATGAGCGCGGC
CAAACTCCACTCTTTCGTGCTGCTGCGGGTGGGCACGTGGAGGTGGTTCG
GACGCTTCTCGGACGGGACGACGTCAATCCCAACACGCTTGACAAATCAG
GCCAAACACCACTCCATTATGCTACTTGGAATAGGCGTGAGGGAGTGGTG
AAAATGCTACTCGGACGGAGCGATGTCAACCCCAACGTAACAGATGACAC
CGGCCTAACACCCCTCCATGATTCCGCTGAGGGTGGGCATGAAGAAGTTG
TAAACCTGCTGCTCGGACGGCAAGATGTCAACCCCGATAAACCAGATATA
GACGGCCAAACACCACTCTGGTGTGCCGCTCGGAATGGGCATGAGGGAGT
GGTGAAAATACTACTCGGACGGGCCGACGTCGACTCCAGCAAACCAGATA
ATTACGGCCACACGCCACTCTGGTGGGCTACTACGAATGGCCATGCGGGA
GTGGTGGCGCTACTACAGTCTCAACCATCTGCCTCCTGCAGCACAGCCTA
AGCCGAGGAGGCACTCCCCCTCCTTACCT

Sequences in the Contig:

SY0AAA53YE23FM1 SY0AAB17YF03FM1 SY0AAB43YO03FM1