Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1512
Length(NT) : 2484
Best Gene Model Blast : Link to GSTUMT00007532001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein FG06307.1
Accession: ref|XP_386483.1| Score: 1094 E_value: 1e-117
KEGG Definition: hypothetical protein
Accession: fgr:FG06307.1 Score: 1094 E_value: 1e-117
KOG Definition:
Classification: [Extracellular structures].
Kog Number: KOG4726 Score: 152 E_value: 2e-10
PFAM Definition: zf-H2C2, His(2)-Cys(2) zinc finger. This domain binds to histone upstream activating sequence (UAS) elements that are found in histone gene promoters..
Pfam Number: pfam09337 Score: 193 E_value: 4e-15
Swissprot: P35208|SPT10_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0004402 = Molecular function: histone acetyltransferase activity
GO:0043565 = Molecular function: sequence-specific DNA binding
GO:0006338 = Biological process: chromatin remodeling
GO:0006281 = Biological process: DNA repair
GO:0045816 = Biological process: negative regulation of transcription from RNA polymerase II promoter, global

Sequence:
>Contig1512
TTGGATAAAATTTGCCCTGTCCGAGAGAAGCGTCGCAGACCAGAGCTCTC
CTCCAGCGCGCTTTCACGAGGGAATACGAAGCACTGCTCTGCGCATACCA
CACCGAGTCCGTAGCTGTTTTCTCCCCGGCAAGACCGTTCTCAATTCTCC
TTGCGTTCCCAGATTCACGAAGGACCACAAAGTACGCCTTCTGCGGGGAA
GAATTGAGCAGGAAGCAAGCAGCAAGCACACCTCAAGGCCGCCAAAAGGG
CCAGACTCACCCACACACCCCGCAATCTCAGATCTGCAGCAGCCGTGAGC
AATATTCATCATGGCTGATCAAACTGCTACAGATCACCAACGAGCTATGC
AACATCAACAGCAACAACAACACCAGCAAACCCGAGACTCCCTTTCTTCT
TCACCATCACGACACTCTTCGACTAATTCAGCGCTTGAAAATCCTGACGC
TCAGGTCCTTCCACCTCCAAACCCAAATCCTGTCCTTCATCCCCGCTCAG
TCTATTTACGGGATCATGTTTCCATTGCAACTGTGCACCCGGTTATGCAC
ACCTCACAGATTCCGGCCTCGCTGATAGCCTTCCTTTGGACTGAGGTCAA
TAACGAAATTGAGCGAGGCAACACCTATCCTCTAGAGGAGCCGATGTCAT
TAGAGAAATTTACTAGCTACTGGTTCGGTACTTTCGGGGCTGTCATGTTG
CTCGGTGGGAAAGAGGAGCAAACGGATCTCCTAGTTGAGCGAGATTGGAG
CACACAGTGCCTTGGGACCTTTTACGTGAAGCCTAATTATCCTGGCCGCA
GCTCACACATTTGCAGTGCGGGATTTCTAACGACATTCGCAGCTCGAGGG
AAAGGCTGTGGTAAACATCTTGGAGAGGCTTATCTCGATTATGCTCCGAA
ACTTGGATATACCTACTCGATGTTCAATCTCGTTTACGAGACCAACATCG
CATCCTGCAAAATCTGGGACAGCTTGGGGTTTAAACGAATTGGAAAGGTC
AAGGGAGCCGGCCGTCTTCGTTCATCAAACTACTTGGTCGATGCCATTAT
CTTTGGACGAGATCTTAACGATGATGAAGACTATGTCTCTGATGAACGCT
TTGATAAGATCAGATTCTACCTTGAAAAGGGCAAATATCCACCCACCGCA
GACCGTTCCGAAAAATCTCGACTTCGATCTGCGGCAACCCATTATAAGCT
CGAAAATGGCAAACTAATGCTCAAGGATAAGGAAGTAGTATCCGACGGTC
AAATGCAATACGAGATTGCGAGGTCAATTCACTGCCAGTCCCACGGTGGT
ATTAACAAGACCACTGCTAGTATCGCGGAGAAGTTTCATTGGGTTCGGAT
TAAGGAAACAGTTTCTCAGGTCATTCGCAACTGCGCCGAATGTAAGGAGC
ATGCGAAGGCTCCTGTGGTCAAAGGAGATCGGTTCAATGGTTCTCCAGTC
AATTCCACCCCACCGCAACCCCAGCAGCAGCAGCAACAACCTCAGCAACC
AGGACAGCAGCACCCGCACCCGCACCCGCACCCGCACCCGCAACAGCAAC
AGCAACAACAACAGCAATTACCACTTTCACTCACACTACCGCAGCAGCAG
CTCCAACAACCTCAATTGCAGCAAATCTCTCCAAACACCCAGGCCCTGGC
TCATCCAGCGTCAGCAGCAGCAACAGGCAGCAGCAGCCCGCGCCGCTGCC
GCACAAATGGACATCCCCGTCGACCCCGCTATGATGGAAGATGTCCAGCA
CACACACCACATTCCCCAGCAATTCGCCCCAGTTGCAAACATGCGCATGG
ACGCCGCCCCTCCCCCACATGGTCCCGACAACACAGCCACTGCTGCGGTT
ACCATCAATGTCAACCAGACCATGGGTGGTACATCCGCCCAGGCTTCCCA
CCAACAGCGCGCCGCCGCGGTAGCCGCCGCGAGAGCTGCGCTGAGTGAAG
GTGACGTATTGACGGAGGAGGATAGGACCATGCGCGACCAGCACCTGATG
GATAGGCTTATGGCTGAAATGAAGAGGGAGCCCGGCCAGGATATGACTGT
TCCATTCCAAGGAGCTGTCGGTGTTGGAGTCGAGGACGATGATACCGCGG
TTGCTAGGCAGCTCAGAGAAGATATGGAGATCGAACGGTAAGGTGGATTC
TACCGAATTATTGATCACCTCTTTTTCCCCTGATTCCCTCCCTCTACTGT
TGTTTCTTTATCATCACTAGCGCTACAAACACTGCTTTTTTAACATTCTC
TTTGTTTTATGATCGCTTTTACACGACGTATGCATTGGGAACCAGCCATA
CAGGGCGGGTGAGAATTGGCGGCTGTTATATCGGTTCTACTGACACTCCT
CGCGGGGGCGGGGAGGGAAAAAAAAGACGGTATTTTGGAGAAAACTTAGA
GGCAGCATTTATTTTCATCTTTCCTTTCCTTTTCCTACTCCTTTCCCCCC
TCCTTTCCCTCTCATCCCCTTTTCCACCACTCTT

Sequences in the Contig:

SY0AAA13YP21FM1 SY0AAA34YB08FM1 SY0AAA53YE03FM1
SY0AAC27YO08FM1 SY0AAC53YA21FM1 SY0AAC62YJ08FM1
SY0AAD13YF06FM1 SY0AAD44YK04FM1 SY0AAD49YP10FM1
SY0AAD5YJ20FM1 SY0AAD9YN22FM1