Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1510
Length(NT) : 1213
Best Gene Model Blast : Link to GSTUMT00004381001 E-value : 0.0
Numbers of ESTs : 28

Blast Results:

Nr Definition: vacuolar ATP synthase catalytic subunit A
Accession: ref|XP_001487188.1| Score: 1686 E_value: 0.0
KEGG Definition: ADR102Wp [EC:3.6.3.14]; K02145 V-type H+-transporting ATPase subunit A
Accession: ago:AGOS_ADR102W Score: 1650 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1352 Score: 1859 E_value: 0.0
PFAM Definition: ATP-synt_ab, ATP synthase alpha/beta family, nucleotide-binding domain. This family includes the ATP synthase alpha and beta subunits, the ATP synthase associated with flagella and the termination factor Rho..
Pfam Number: pfam00006 Score: 485 E_value: 2e-49
Swissprot: Q9UVJ8|VATA_ASHGO

Sequence:
>Contig1510
TTTACAATCCTCCTTCAGAGAACCCGCTTTACTTTTAACGTCCTGATACC
TAACTATGTCCAAAAATGCAGAGGCACGAAGGGCAGGGGAGAACGCGAAG
GAAGGAGATTATGGTTCTATTTTCTCGGTCTCTGGGCCCGTCGTGGTGGC
AGAGAACATGATAGGATGTGCTATGTACGAGCTGGTCCGTGTTGGACATG
ATTTGCTGGTTGGGGAGGTCATTCGAATAGAAGCCGACAAAGCTACAATT
CAGGTTTACGAGGAAACAGCTGGTGTAACTGTTGGAGATCCTGTCTTGCG
TACCGGGAAGCCCCTCTCCGTGGAGCTTGGCCCTGGGTTGATGGAGACCA
TCTACGATGGGATTCAACGACCTCTAAAGACTATTAACGAGATTTCGAAT
AGTATCTACATTCCTCGCGGTATCTCAACGCCTGCCCTGGACCGTAAGAG
GTCGTGGGACTTCAATCCTGGAGGTCTCAAGGTCGGGGATCACATCACCG
GAGGAGATATCTACGGGAGTGTCTACGAAAACTCGCTTCTCGATGATCAC
AAAATCCTTCTACCCCCTCGTGCTCGGGGTACCATCACTCATATTTCTGA
GAAGGGCTCCTACACCTTAGAGGATACGGTTCTCGAAATCGAGTTCGAGG
GCAAGAAGCAGAACTTTACCATGATGCATACGTGGCCTGTGCGGGTCGCC
AGACCGGTGTCTGAGAAACTTTCCGCAGATTACCCTCTATTGACTGGTCA
GAGAGTGTTGGATGCCCTGTTCCCTTGCGTACAAGGTGGCACAACAGCTA
TTCCTGGAGCTTTCGGTTGCGGAAAAACTGTTATTTCTCAGTCTTTATCG
AAATATTCTAACTCCGACTGTATTATCTACGTCGGATGTGGTGAGCGTGG
TAACGAGATGGCTGAAGTCTTGATGGATTTCCCTGAGCTTTCTATTGAGA
TTAATGGTCGTAAAGAACCCATCATGAAGCGGACAACACTCGTTGCAAAT
ACCTCCAATATGCCTGTCGCGGCGCGTGAAGCATCTATTTATACCGGAAT
TACGCTTGCGGAATACTTCCGTGACCAAGGAAAGGACGTTGCGATGATGG
CCGACTCGTCTTCCCGCTGGGCCGAAGCCCTTCGTGAGATTTCTGGTCGT
CTCGGGGAAATGCCGGCTGATCAAGGTTTTCCGGCTTACCTGGGTGCTAA
ATTGGCGAGTTTC

Sequences in the Contig:

SY0AAA11YI03FM1 SY0AAA41YK16FM1 SY0AAA41YN05FM1
SY0AAA53YD13FM1 SY0AAA61YN09FM1 SY0AAB23YA19FM1
SY0AAB27YG06FM1 SY0AAB36YD15FM1 SY0AAB41YE05FM1
SY0AAB53YC13FM1 SY0AAC25YJ23FM1 SY0AAC28YO16FM1
SY0AAC2YD07FM1 SY0AAC34YN08FM1 SY0AAC35YI11FM1
SY0AAC36YL08FM1 SY0AAC37YD14FM1 SY0AAC54YL11FM1
SY0AAC54YN05FM1 SY0AAD12YF13FM1 SY0AAD20YP11FM1
SY0AAD2YB04FM1 SY0AAD30YK13FM1 SY0AAD31YJ09FM1
SY0AAD45YP18FM1 SY0AAD58YM10FM1 SY0AAD6YI02FM1
SY0AAD6YJ13FM1