Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1509
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00010555001 E-value : 1e-168
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1509
TTGGTGGGAAGCTTGGAAATACCCACGATTTGCTTCTTCTGCTGGTACAT
TATTGAAGGGTTTTCCTTTTGCACGGAGCTGTACCATACCAGTTCGTACC
GGTACACTACCCTGCCGCACCATAGCATATCTTGCCCGCTTCAACCTTAC
AGCCCGCCGAAGACAACCTTGTCCAAAATATTTCTGCAACCCTGACTATA
CCTGCCGTCACTCTTATTCGGTGAGAAGGGTGGGAGAATGAATCGTCAGA
GTGTTAGCATGTCCGATCATCGGGACGCAAGAGGTCAAAGAATGCCACTG
CCTACTCAACATGATTCCCCTTGGGAGCATGTACTCCCGTCCCAGCGCCC
ACACCTAGCTTCCCAAGCGGGACTTGAAGGGGGAGTTTTTATATCTAGAG
CCACATCTCTCGAATTACCCCCCCCAGGAGATTTACACGGTCAATTGAAC
AGTTCCGAAAGTGCTTCTCCCATGTCTGCGTATTCGAGTGGAAGCATCCA
CAGTCATGGCTATGAGAGCGGCGACTCGCCACCGCCCTCAGCCCGGGAAT
GGGAGCATTCAGACCGTGAAAATTCTAGTTGGTCTATACCTTCGTTGGCT
CCTCGGGGTACGAGTGCTGGCGCGACGTCCCCATCTAGCGCGGGAAATTT
CACCGAGACATCAAGCAACAGGGAAGGCTTCTCCGAGACTGCGGGGAGCA
ACGGTAGCTCTCCGTACTCTGGTGCCTCCGAACAGGACGATTCCGGTGCA
GCTGCTGAGCCTGAGGCAA

Sequences in the Contig:

SY0AAA21YK09FM1 SY0AAA4YO18FM1 SY0AAA53YD02FM1