Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1508
Length(NT) : 816
Best Gene Model Blast : Link to GSTUMT00002085001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: zinc metalloproteinase, putative
Accession: ref|XP_001268994.1| Score: 483 E_value: 8e-47
KEGG Definition: hypothetical protein
Accession: ani:AN1049.2 Score: 477 E_value: 2e-46
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG4842 Score: 268 E_value: 2e-24
PFAM Definition: WLM, WLM domain. This is a predicted metallopeptidase domain called WLM (Wss1p-like metalloproteases). These are linked to the Ub-system by virtue of fusions with the UB-binding PUG (PUB), Ub-like, and Little Finger domains. More specifically, genetic evidence implicates the WLM family in de-SUMOylation..
Pfam Number: pfam08325 Score: 401 E_value: 7e-40

Sequence:
>Contig1508
TTGGTACCGGTATCCACGACTCAAGCTTTCTTCTTCTTCCTCCACCTACC
TTCACTAACGTCTGGGTGGAACACTTCCCCCCACCACAACCATGGCCCGA
ACCACCCCCACCCCCTACACCTTCCAAACCATCCGCCCACTCCCACACCT
TCCCAACAGCGCGACCAGCCATGCCTTCCTCACCCGCCTCGCCACAGACC
CGGGCATCCGGCACGTCATGGCAAAATATAGATGGACAGTCCCGCTCCTG
CTAGAAGTGGAACCACTGGGCAACACAACGCACGACAGCAAAACCCTCGG
CCTAAATCGCAACCGCGGCGCCGTGATAGAGTTAAGGCTGAGGACGGACT
GGTACGATGGGTGGCGGGATTACAAGACGGTGCGGAGGACGCTGTGCCAT
GAGCTCGCGCATAATGTATGGGATGGGCACGGGAGGGAGTTTTGGGAGCT
TACCAATAAACTAGAGAAGGAGGTTGAAGCGAATGATTGGAAGAGTGGCG
GGCGCGCGCTCACGGATCAGGTGTTTTATAATCCACCTGAGGCGGAGGCT
CCAGAGAAGGGGTGGGAAGGGGGGGAGTTTAGACTTGGCGGTGGTGGGGG
TGGGGAAGGACCGGCCGCGATGGTGAAGATGAACAGTGGTTCAATGGTGG
AGGGGAGTCAGCCTAGTATGCGGGAAGTATTGGCTAAAGCAGCCGAGGAG
AGGATGAAGAGGCAGGCCGCGGCGGCAGCGGCGGGGAGACAGAAGACTTG
ATATTTGATGGGTTTCTGCATATTATAATACCTTAGAATGTATTCTTCTA
CCGGTAGATCGGTGAA

Sequences in the Contig:

SY0AAA53YC20FM1 SY0AAB46YI23FM1 SY0AAB51YM20FM1