Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1507
Length(NT) : 735
Best Gene Model Blast : Link to GSTUMT00000615001 E-value : 1e-166
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An11g06930
Accession: ref|XP_001394671.1| Score: 375 E_value: 4e-58
KEGG Definition: hypothetical protein
Accession: ang:An11g06930 Score: 375 E_value: 2e-58
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2949 Score: 272 E_value: 5e-25
PFAM Definition: Pantoate_transf, Ketopantoate hydroxymethyltransferase. Ketopantoate hydroxymethyltransferase (EC:2.1.2.11) is the first enzyme in the pantothenate biosynthesis pathway..
Pfam Number: pfam02548 Score: 331 E_value: 7e-32
Swissprot: Q9Y7B6|PANB_EMENI

Sequence:
>Contig1507
TTGGCAACACCGTCCTCACTCCTGAACTGGAATGAGTCTGCACAGATCAT
CTCTACTTTTTCCTCTTCGTTGGGCAGCTACTGCCACAGTGGGTGCCGGG
AGAGCTCCATTGTGCCGACAAGTGCTGCGACGCCAACGGCTCATGTACTC
TTCCCACTCCCCCATCTCGCCAATAGCCGGACCCCCGCGGAAAAAGGTGA
CAATAAACACGCTTCGGGGTATGCACGCTTCCAAAACGGCCATCGCTATG
ATGACCGCCCATGATTTCCCTTCCGGTCTTGTCGCTGATGAGGGGGGTAT
GGATATGATCCTCGTTGGGGACTCGTTGGCTATGGTGGCTTTGGGAATGA
AGGACACGAACCAAGTTAAACTAGACGTAATTACTCGTTTGGCCCTTTGC
TTCCTCTTGAAGAGCTATGATGGGAGCAAACAGTCTGTTAGGATATACTG
CATCATTGCCGCGCTGTCTCGAGGGGTGTTCGGTCCGCTTTCACGATAGG
CGATCTGCCGATGGGTTCATACGAGGTTTCCCCTGAGCACGCCGTTTCCT
CTTCTATCCGGATGATCCAAGATGGCCGGGTGGAGGCCGTCAAACTCGAA
GGCGGCATTGAATTAGCCCCTACAATATCTAGGATCACCTCTATTGGCAT
CCCGGTCCTTGGTCACATAGGTCTCACCCCGCAGCGCTCACACTCCCTCG
GGGGCTTCCGCGTACAAGGCAGGACTGCTGCTAGC

Sequences in the Contig:

SY0AAA19YP20FM1 SY0AAA53YC16FM1 SY0AAD27YB04FM1